| Variant ID: vg0912499541 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 12499541 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, C: 0.04, others allele: 0.00, population size: 113. )
ATGGAAAAGTTGTGAACAACAAAGTTGTATAACTTATCAAGATCTATAACTTTTGTTTTGGTCATTTTTCTATATGACTTTGTTTGAACAATTTGAATTT[C/G]
AATTTAAAATTATAACAACTTCAAACAGCATTTTAAAATACTAATTGATTTCAACTGAAAAAGTCATCAATAACAAAGTTGTATAAATCATCAAGATCTA
TAGATCTTGATGATTTATACAACTTTGTTATTGATGACTTTTTCAGTTGAAATCAATTAGTATTTTAAAATGCTGTTTGAAGTTGTTATAATTTTAAATT[G/C]
AAATTCAAATTGTTCAAACAAAGTCATATAGAAAAATGACCAAAACAAAAGTTATAGATCTTGATAAGTTATACAACTTTGTTGTTCACAACTTTTCCAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.20% | 0.80% | 9.54% | 51.40% | NA |
| All Indica | 2759 | 5.50% | 1.30% | 13.37% | 79.81% | NA |
| All Japonica | 1512 | 94.30% | 0.00% | 1.26% | 4.43% | NA |
| Aus | 269 | 39.00% | 0.40% | 13.75% | 46.84% | NA |
| Indica I | 595 | 10.60% | 0.50% | 4.03% | 84.87% | NA |
| Indica II | 465 | 4.10% | 1.90% | 8.82% | 85.16% | NA |
| Indica III | 913 | 1.10% | 1.00% | 22.12% | 75.79% | NA |
| Indica Intermediate | 786 | 7.50% | 2.00% | 12.98% | 77.48% | NA |
| Temperate Japonica | 767 | 97.90% | 0.00% | 0.13% | 1.96% | NA |
| Tropical Japonica | 504 | 88.10% | 0.00% | 3.57% | 8.33% | NA |
| Japonica Intermediate | 241 | 95.90% | 0.00% | 0.00% | 4.15% | NA |
| VI/Aromatic | 96 | 69.80% | 2.10% | 19.79% | 8.33% | NA |
| Intermediate | 90 | 63.30% | 0.00% | 7.78% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0912499541 | C -> G | LOC_Os09g20740.1 | upstream_gene_variant ; 969.0bp to feature; MODIFIER | silent_mutation | Average:8.713; most accessible tissue: Callus, score: 26.926 | N | N | N | N |
| vg0912499541 | C -> G | LOC_Os09g20750.1 | downstream_gene_variant ; 3059.0bp to feature; MODIFIER | silent_mutation | Average:8.713; most accessible tissue: Callus, score: 26.926 | N | N | N | N |
| vg0912499541 | C -> G | LOC_Os09g20740-LOC_Os09g20750 | intergenic_region ; MODIFIER | silent_mutation | Average:8.713; most accessible tissue: Callus, score: 26.926 | N | N | N | N |
| vg0912499541 | C -> DEL | N | N | silent_mutation | Average:8.713; most accessible tissue: Callus, score: 26.926 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0912499541 | NA | 4.64E-27 | mr1024 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912499541 | NA | 2.25E-09 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912499541 | NA | 4.47E-15 | mr1940 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912499541 | NA | 2.43E-09 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |