\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912499541:

Variant ID: vg0912499541 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 12499541
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, C: 0.04, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


ATGGAAAAGTTGTGAACAACAAAGTTGTATAACTTATCAAGATCTATAACTTTTGTTTTGGTCATTTTTCTATATGACTTTGTTTGAACAATTTGAATTT[C/G]
AATTTAAAATTATAACAACTTCAAACAGCATTTTAAAATACTAATTGATTTCAACTGAAAAAGTCATCAATAACAAAGTTGTATAAATCATCAAGATCTA

Reverse complement sequence

TAGATCTTGATGATTTATACAACTTTGTTATTGATGACTTTTTCAGTTGAAATCAATTAGTATTTTAAAATGCTGTTTGAAGTTGTTATAATTTTAAATT[G/C]
AAATTCAAATTGTTCAAACAAAGTCATATAGAAAAATGACCAAAACAAAAGTTATAGATCTTGATAAGTTATACAACTTTGTTGTTCACAACTTTTCCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.20% 0.80% 9.54% 51.40% NA
All Indica  2759 5.50% 1.30% 13.37% 79.81% NA
All Japonica  1512 94.30% 0.00% 1.26% 4.43% NA
Aus  269 39.00% 0.40% 13.75% 46.84% NA
Indica I  595 10.60% 0.50% 4.03% 84.87% NA
Indica II  465 4.10% 1.90% 8.82% 85.16% NA
Indica III  913 1.10% 1.00% 22.12% 75.79% NA
Indica Intermediate  786 7.50% 2.00% 12.98% 77.48% NA
Temperate Japonica  767 97.90% 0.00% 0.13% 1.96% NA
Tropical Japonica  504 88.10% 0.00% 3.57% 8.33% NA
Japonica Intermediate  241 95.90% 0.00% 0.00% 4.15% NA
VI/Aromatic  96 69.80% 2.10% 19.79% 8.33% NA
Intermediate  90 63.30% 0.00% 7.78% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0912499541 C -> G LOC_Os09g20740.1 upstream_gene_variant ; 969.0bp to feature; MODIFIER silent_mutation Average:8.713; most accessible tissue: Callus, score: 26.926 N N N N
vg0912499541 C -> G LOC_Os09g20750.1 downstream_gene_variant ; 3059.0bp to feature; MODIFIER silent_mutation Average:8.713; most accessible tissue: Callus, score: 26.926 N N N N
vg0912499541 C -> G LOC_Os09g20740-LOC_Os09g20750 intergenic_region ; MODIFIER silent_mutation Average:8.713; most accessible tissue: Callus, score: 26.926 N N N N
vg0912499541 C -> DEL N N silent_mutation Average:8.713; most accessible tissue: Callus, score: 26.926 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0912499541 NA 4.64E-27 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912499541 NA 2.25E-09 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912499541 NA 4.47E-15 mr1940 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912499541 NA 2.43E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251