Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912499541:

Variant ID: vg0912499541 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 12499541
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, C: 0.04, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

ATGGAAAAGTTGTGAACAACAAAGTTGTATAACTTATCAAGATCTATAACTTTTGTTTTGGTCATTTTTCTATATGACTTTGTTTGAACAATTTGAATTT[C/G]
AATTTAAAATTATAACAACTTCAAACAGCATTTTAAAATACTAATTGATTTCAACTGAAAAAGTCATCAATAACAAAGTTGTATAAATCATCAAGATCTA

Reverse complement sequence

TAGATCTTGATGATTTATACAACTTTGTTATTGATGACTTTTTCAGTTGAAATCAATTAGTATTTTAAAATGCTGTTTGAAGTTGTTATAATTTTAAATT[G/C]
AAATTCAAATTGTTCAAACAAAGTCATATAGAAAAATGACCAAAACAAAAGTTATAGATCTTGATAAGTTATACAACTTTGTTGTTCACAACTTTTCCAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.20%	0.80%	9.54%	51.40%	NA
All Indica	2759	5.50%	1.30%	13.37%	79.81%	NA
All Japonica	1512	94.30%	0.00%	1.26%	4.43%	NA
Aus	269	39.00%	0.40%	13.75%	46.84%	NA
Indica I	595	10.60%	0.50%	4.03%	84.87%	NA
Indica II	465	4.10%	1.90%	8.82%	85.16%	NA
Indica III	913	1.10%	1.00%	22.12%	75.79%	NA
Indica Intermediate	786	7.50%	2.00%	12.98%	77.48%	NA
Temperate Japonica	767	97.90%	0.00%	0.13%	1.96%	NA
Tropical Japonica	504	88.10%	0.00%	3.57%	8.33%	NA
Japonica Intermediate	241	95.90%	0.00%	0.00%	4.15%	NA
VI/Aromatic	96	69.80%	2.10%	19.79%	8.33%	NA
Intermediate	90	63.30%	0.00%	7.78%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0912499541	C -> G	LOC_Os09g20740.1	upstream_gene_variant ; 969.0bp to feature; MODIFIER	silent_mutation	Average:8.713; most accessible tissue: Callus, score: 26.926	N	N	N	N
vg0912499541	C -> G	LOC_Os09g20750.1	downstream_gene_variant ; 3059.0bp to feature; MODIFIER	silent_mutation	Average:8.713; most accessible tissue: Callus, score: 26.926	N	N	N	N
vg0912499541	C -> G	LOC_Os09g20740-LOC_Os09g20750	intergenic_region ; MODIFIER	silent_mutation	Average:8.713; most accessible tissue: Callus, score: 26.926	N	N	N	N
vg0912499541	C -> DEL	N	N	silent_mutation	Average:8.713; most accessible tissue: Callus, score: 26.926	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0912499541	NA	4.64E-27	mr1024	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912499541	NA	2.25E-09	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912499541	NA	4.47E-15	mr1940	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912499541	NA	2.43E-09	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251