Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0912448061:

Variant ID: vg0912448061 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 12448061
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCCAAAACAGCAATCTAAACCGCCGAGGGACCTCGTTTGCACCGGTTTTGATAGTTGAGGGATCTATTGTATCTGGTTTTCTGGTTGAAGGATGAAAAC[T/C]
AGATTCGTTGACAAGTTAAGTGACCTCAGATGAATTTATTCCTTTTTTTTTTCAATCCGGCCCCTGTTTCTGCAAAGCCAGAGGTGCCTGTAGAGAATCT

Reverse complement sequence

AGATTCTCTACAGGCACCTCTGGCTTTGCAGAAACAGGGGCCGGATTGAAAAAAAAAAGGAATAAATTCATCTGAGGTCACTTAACTTGTCAACGAATCT[A/G]
GTTTTCATCCTTCAACCAGAAAACCAGATACAATAGATCCCTCAACTATCAAAACCGGTGCAAACGAGGTCCCTCGGCGGTTTAGATTGCTGTTTTGGCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.80% 3.40% 14.81% 26.98% NA
All Indica  2759 29.10% 4.90% 23.74% 42.19% NA
All Japonica  1512 95.00% 0.10% 0.53% 4.43% NA
Aus  269 75.10% 5.90% 7.06% 11.90% NA
Indica I  595 8.10% 2.40% 10.76% 78.82% NA
Indica II  465 51.20% 1.10% 15.91% 31.83% NA
Indica III  913 28.10% 8.70% 39.87% 23.33% NA
Indica Intermediate  786 33.20% 4.80% 19.47% 42.49% NA
Temperate Japonica  767 98.40% 0.00% 0.13% 1.43% NA
Tropical Japonica  504 89.10% 0.00% 1.19% 9.72% NA
Japonica Intermediate  241 96.30% 0.40% 0.41% 2.90% NA
VI/Aromatic  96 79.20% 9.40% 7.29% 4.17% NA
Intermediate  90 78.90% 0.00% 12.22% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0912448061 T -> DEL N N silent_mutation Average:92.498; most accessible tissue: Minghui63 young leaf, score: 97.49 N N N N
vg0912448061 T -> C LOC_Os09g20660.1 upstream_gene_variant ; 2195.0bp to feature; MODIFIER silent_mutation Average:92.498; most accessible tissue: Minghui63 young leaf, score: 97.49 N N N N
vg0912448061 T -> C LOC_Os09g20660.2 upstream_gene_variant ; 2195.0bp to feature; MODIFIER silent_mutation Average:92.498; most accessible tissue: Minghui63 young leaf, score: 97.49 N N N N
vg0912448061 T -> C LOC_Os09g20660.3 upstream_gene_variant ; 2195.0bp to feature; MODIFIER silent_mutation Average:92.498; most accessible tissue: Minghui63 young leaf, score: 97.49 N N N N
vg0912448061 T -> C LOC_Os09g20670.1 downstream_gene_variant ; 42.0bp to feature; MODIFIER silent_mutation Average:92.498; most accessible tissue: Minghui63 young leaf, score: 97.49 N N N N
vg0912448061 T -> C LOC_Os09g20670-LOC_Os09g20684 intergenic_region ; MODIFIER silent_mutation Average:92.498; most accessible tissue: Minghui63 young leaf, score: 97.49 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0912448061 T C -0.04 -0.02 0.0 -0.04 -0.04 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0912448061 NA 7.00E-19 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912448061 NA 2.39E-19 mr1167_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912448061 NA 3.36E-36 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912448061 NA 9.40E-23 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912448061 NA 4.40E-15 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912448061 NA 1.39E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251