\
| Variant ID: vg0912355268 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 12355268 |
| Reference Allele: T | Alternative Allele: C,G |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 94. )
AATTTGAACATGTATATTTGTGGAGTATAATATCACATGTTAATACACTTTCTCATTTTTTTTTAATTTTTTTATAATTATTTAAGTGTCATGCAAATAA[T/C,G]
AAGGGGACTGAGGGATTAAAATACTTTCTCACCCTCATCGCATCGCGTGCTTCCCACCAGCTTTCACCTCGTGAGCACCTCTACTCCATCCCACGTCCAA
TTGGACGTGGGATGGAGTAGAGGTGCTCACGAGGTGAAAGCTGGTGGGAAGCACGCGATGCGATGAGGGTGAGAAAGTATTTTAATCCCTCAGTCCCCTT[A/G,C]
TTATTTGCATGACACTTAAATAATTATAAAAAAATTAAAAAAAAATGAGAAAGTGTATTAACATGTGATATTATACTCCACAAATATACATGTTCAAATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.80% | 42.60% | 0.13% | 0.40% | G: 0.08% |
| All Indica | 2759 | 86.20% | 13.10% | 0.04% | 0.62% | NA |
| All Japonica | 1512 | 5.90% | 94.00% | 0.07% | 0.07% | NA |
| Aus | 269 | 61.00% | 38.30% | 0.37% | 0.00% | G: 0.37% |
| Indica I | 595 | 98.00% | 0.30% | 0.00% | 1.68% | NA |
| Indica II | 465 | 58.30% | 41.50% | 0.00% | 0.22% | NA |
| Indica III | 913 | 95.60% | 4.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 83.00% | 16.30% | 0.00% | 0.76% | NA |
| Temperate Japonica | 767 | 1.80% | 98.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 12.70% | 87.10% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 4.60% | 95.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 26.00% | 69.80% | 2.08% | 1.04% | G: 1.04% |
| Intermediate | 90 | 30.00% | 66.70% | 1.11% | 0.00% | G: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0912355268 | T -> G | LOC_Os09g20490.1 | upstream_gene_variant ; 561.0bp to feature; MODIFIER | silent_mutation | Average:70.251; most accessible tissue: Callus, score: 98.128 | N | N | N | N |
| vg0912355268 | T -> G | LOC_Os09g20480-LOC_Os09g20490 | intergenic_region ; MODIFIER | silent_mutation | Average:70.251; most accessible tissue: Callus, score: 98.128 | N | N | N | N |
| vg0912355268 | T -> DEL | N | N | silent_mutation | Average:70.251; most accessible tissue: Callus, score: 98.128 | N | N | N | N |
| vg0912355268 | T -> C | LOC_Os09g20490.1 | upstream_gene_variant ; 561.0bp to feature; MODIFIER | silent_mutation | Average:70.251; most accessible tissue: Callus, score: 98.128 | N | N | N | N |
| vg0912355268 | T -> C | LOC_Os09g20480-LOC_Os09g20490 | intergenic_region ; MODIFIER | silent_mutation | Average:70.251; most accessible tissue: Callus, score: 98.128 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0912355268 | NA | 3.37E-06 | mr1425 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912355268 | NA | 6.50E-10 | mr1557 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912355268 | NA | 1.12E-19 | mr1598 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912355268 | NA | 1.00E-07 | mr1598 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912355268 | NA | 5.12E-06 | mr1944 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912355268 | NA | 1.12E-09 | mr1349_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912355268 | NA | 9.58E-16 | mr1717_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912355268 | NA | 9.52E-08 | mr1717_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912355268 | NA | 2.53E-13 | mr1770_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912355268 | NA | 6.33E-08 | mr1895_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912355268 | 6.82E-06 | 6.59E-12 | mr1895_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912355268 | NA | 1.84E-06 | mr1910_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |