\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912355268:

Variant ID: vg0912355268 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 12355268
Reference Allele: TAlternative Allele: C,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


AATTTGAACATGTATATTTGTGGAGTATAATATCACATGTTAATACACTTTCTCATTTTTTTTTAATTTTTTTATAATTATTTAAGTGTCATGCAAATAA[T/C,G]
AAGGGGACTGAGGGATTAAAATACTTTCTCACCCTCATCGCATCGCGTGCTTCCCACCAGCTTTCACCTCGTGAGCACCTCTACTCCATCCCACGTCCAA

Reverse complement sequence

TTGGACGTGGGATGGAGTAGAGGTGCTCACGAGGTGAAAGCTGGTGGGAAGCACGCGATGCGATGAGGGTGAGAAAGTATTTTAATCCCTCAGTCCCCTT[A/G,C]
TTATTTGCATGACACTTAAATAATTATAAAAAAATTAAAAAAAAATGAGAAAGTGTATTAACATGTGATATTATACTCCACAAATATACATGTTCAAATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.80% 42.60% 0.13% 0.40% G: 0.08%
All Indica  2759 86.20% 13.10% 0.04% 0.62% NA
All Japonica  1512 5.90% 94.00% 0.07% 0.07% NA
Aus  269 61.00% 38.30% 0.37% 0.00% G: 0.37%
Indica I  595 98.00% 0.30% 0.00% 1.68% NA
Indica II  465 58.30% 41.50% 0.00% 0.22% NA
Indica III  913 95.60% 4.30% 0.11% 0.00% NA
Indica Intermediate  786 83.00% 16.30% 0.00% 0.76% NA
Temperate Japonica  767 1.80% 98.00% 0.00% 0.13% NA
Tropical Japonica  504 12.70% 87.10% 0.20% 0.00% NA
Japonica Intermediate  241 4.60% 95.40% 0.00% 0.00% NA
VI/Aromatic  96 26.00% 69.80% 2.08% 1.04% G: 1.04%
Intermediate  90 30.00% 66.70% 1.11% 0.00% G: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0912355268 T -> G LOC_Os09g20490.1 upstream_gene_variant ; 561.0bp to feature; MODIFIER silent_mutation Average:70.251; most accessible tissue: Callus, score: 98.128 N N N N
vg0912355268 T -> G LOC_Os09g20480-LOC_Os09g20490 intergenic_region ; MODIFIER silent_mutation Average:70.251; most accessible tissue: Callus, score: 98.128 N N N N
vg0912355268 T -> DEL N N silent_mutation Average:70.251; most accessible tissue: Callus, score: 98.128 N N N N
vg0912355268 T -> C LOC_Os09g20490.1 upstream_gene_variant ; 561.0bp to feature; MODIFIER silent_mutation Average:70.251; most accessible tissue: Callus, score: 98.128 N N N N
vg0912355268 T -> C LOC_Os09g20480-LOC_Os09g20490 intergenic_region ; MODIFIER silent_mutation Average:70.251; most accessible tissue: Callus, score: 98.128 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0912355268 NA 3.37E-06 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912355268 NA 6.50E-10 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912355268 NA 1.12E-19 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912355268 NA 1.00E-07 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912355268 NA 5.12E-06 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912355268 NA 1.12E-09 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912355268 NA 9.58E-16 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912355268 NA 9.52E-08 mr1717_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912355268 NA 2.53E-13 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912355268 NA 6.33E-08 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912355268 6.82E-06 6.59E-12 mr1895_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912355268 NA 1.84E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251