Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912341273:

Variant ID: vg0912341273 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 12341273
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

GTGGGCCGGTGGGGGCCCGTATACGGTGAAGGGCTTAGGGATACCAATATGTGAAGTGGGAGATTGTTGAATAGTCCCACATTGGTTGTGGAAGGGCAAA[G/T]
GACATAAGATTGAAGGGGGGCTGAGGGATACTTCCCTGATGGGGGCCCATTGGTTGTTGGAGGGCAAAGGACCTAAGATTGAAGGGGGGCTGAGGGATAC

Reverse complement sequence

GTATCCCTCAGCCCCCCTTCAATCTTAGGTCCTTTGCCCTCCAACAACCAATGGGCCCCCATCAGGGAAGTATCCCTCAGCCCCCCTTCAATCTTATGTC[C/A]
TTTGCCCTTCCACAACCAATGTGGGACTATTCAACAATCTCCCACTTCACATATTGGTATCCCTAAGCCCTTCACCGTATACGGGCCCCCACCGGCCCAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.00%	6.10%	0.91%	30.03%	NA
All Indica	2759	41.50%	9.50%	1.09%	47.99%	NA
All Japonica	1512	94.60%	1.00%	0.13%	4.30%	NA
Aus	269	87.40%	3.00%	2.60%	7.06%	NA
Indica I	595	11.30%	15.00%	1.18%	72.61%	NA
Indica II	465	58.50%	7.30%	0.43%	33.76%	NA
Indica III	913	55.00%	5.40%	0.88%	38.77%	NA
Indica Intermediate	786	38.50%	11.30%	1.65%	48.47%	NA
Temperate Japonica	767	98.20%	0.10%	0.00%	1.69%	NA
Tropical Japonica	504	88.10%	2.60%	0.40%	8.93%	NA
Japonica Intermediate	241	96.70%	0.40%	0.00%	2.90%	NA
VI/Aromatic	96	95.80%	0.00%	3.12%	1.04%	NA
Intermediate	90	84.40%	3.30%	1.11%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0912341273	G -> DEL	N	N	silent_mutation	Average:68.48; most accessible tissue: Zhenshan97 flower, score: 80.311	N	N	N	N
vg0912341273	G -> T	LOC_Os09g20480.1	upstream_gene_variant ; 4451.0bp to feature; MODIFIER	silent_mutation	Average:68.48; most accessible tissue: Zhenshan97 flower, score: 80.311	N	N	N	N
vg0912341273	G -> T	LOC_Os09g20470.1	downstream_gene_variant ; 1168.0bp to feature; MODIFIER	silent_mutation	Average:68.48; most accessible tissue: Zhenshan97 flower, score: 80.311	N	N	N	N
vg0912341273	G -> T	LOC_Os09g20460-LOC_Os09g20470	intergenic_region ; MODIFIER	silent_mutation	Average:68.48; most accessible tissue: Zhenshan97 flower, score: 80.311	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0912341273	NA	1.58E-06	mr1346	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273	NA	1.55E-06	mr1425	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273	NA	4.19E-07	mr1425	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273	NA	1.33E-07	mr1439	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273	NA	4.13E-06	mr1439	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273	NA	7.50E-07	mr1577	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273	NA	9.98E-06	mr1671	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273	NA	3.24E-06	mr1691	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273	NA	2.35E-06	mr1734	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273	NA	1.24E-06	mr1780	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273	NA	8.19E-07	mr1792	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273	NA	2.95E-06	mr1803	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273	NA	4.67E-06	mr1832	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273	NA	2.15E-06	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273	NA	2.78E-06	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273	NA	1.37E-08	mr1691_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273	NA	4.02E-11	mr1728_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273	NA	1.23E-06	mr1895_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273	NA	2.03E-06	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251