\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912341273:

Variant ID: vg0912341273 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 12341273
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


GTGGGCCGGTGGGGGCCCGTATACGGTGAAGGGCTTAGGGATACCAATATGTGAAGTGGGAGATTGTTGAATAGTCCCACATTGGTTGTGGAAGGGCAAA[G/T]
GACATAAGATTGAAGGGGGGCTGAGGGATACTTCCCTGATGGGGGCCCATTGGTTGTTGGAGGGCAAAGGACCTAAGATTGAAGGGGGGCTGAGGGATAC

Reverse complement sequence

GTATCCCTCAGCCCCCCTTCAATCTTAGGTCCTTTGCCCTCCAACAACCAATGGGCCCCCATCAGGGAAGTATCCCTCAGCCCCCCTTCAATCTTATGTC[C/A]
TTTGCCCTTCCACAACCAATGTGGGACTATTCAACAATCTCCCACTTCACATATTGGTATCCCTAAGCCCTTCACCGTATACGGGCCCCCACCGGCCCAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.00% 6.10% 0.91% 30.03% NA
All Indica  2759 41.50% 9.50% 1.09% 47.99% NA
All Japonica  1512 94.60% 1.00% 0.13% 4.30% NA
Aus  269 87.40% 3.00% 2.60% 7.06% NA
Indica I  595 11.30% 15.00% 1.18% 72.61% NA
Indica II  465 58.50% 7.30% 0.43% 33.76% NA
Indica III  913 55.00% 5.40% 0.88% 38.77% NA
Indica Intermediate  786 38.50% 11.30% 1.65% 48.47% NA
Temperate Japonica  767 98.20% 0.10% 0.00% 1.69% NA
Tropical Japonica  504 88.10% 2.60% 0.40% 8.93% NA
Japonica Intermediate  241 96.70% 0.40% 0.00% 2.90% NA
VI/Aromatic  96 95.80% 0.00% 3.12% 1.04% NA
Intermediate  90 84.40% 3.30% 1.11% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0912341273 G -> DEL N N silent_mutation Average:68.48; most accessible tissue: Zhenshan97 flower, score: 80.311 N N N N
vg0912341273 G -> T LOC_Os09g20480.1 upstream_gene_variant ; 4451.0bp to feature; MODIFIER silent_mutation Average:68.48; most accessible tissue: Zhenshan97 flower, score: 80.311 N N N N
vg0912341273 G -> T LOC_Os09g20470.1 downstream_gene_variant ; 1168.0bp to feature; MODIFIER silent_mutation Average:68.48; most accessible tissue: Zhenshan97 flower, score: 80.311 N N N N
vg0912341273 G -> T LOC_Os09g20460-LOC_Os09g20470 intergenic_region ; MODIFIER silent_mutation Average:68.48; most accessible tissue: Zhenshan97 flower, score: 80.311 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0912341273 NA 1.58E-06 mr1346 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273 NA 1.55E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273 NA 4.19E-07 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273 NA 1.33E-07 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273 NA 4.13E-06 mr1439 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273 NA 7.50E-07 mr1577 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273 NA 9.98E-06 mr1671 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273 NA 3.24E-06 mr1691 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273 NA 2.35E-06 mr1734 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273 NA 1.24E-06 mr1780 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273 NA 8.19E-07 mr1792 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273 NA 2.95E-06 mr1803 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273 NA 4.67E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273 NA 2.15E-06 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273 NA 2.78E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273 NA 1.37E-08 mr1691_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273 NA 4.02E-11 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273 NA 1.23E-06 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912341273 NA 2.03E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251