\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912313203:

Variant ID: vg0912313203 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 12313203
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTGTTCATACGGTAGCCATGAAGCTTAACCCTCGCATGAACATACTAAAACAATGGGAAGTACATTTGCAATTCTATTTATTTATTTATTTATTTAATT[T/A]
ATTTAGTTTATGCTACAAATTCTTATTGACAAGGATTAGCCTTGTGACACATTAAGTGGGTCTAACAATGATTTTAAGCTCTATGTAAATAAAATAAAAC

Reverse complement sequence

GTTTTATTTTATTTACATAGAGCTTAAAATCATTGTTAGACCCACTTAATGTGTCACAAGGCTAATCCTTGTCAATAAGAATTTGTAGCATAAACTAAAT[A/T]
AATTAAATAAATAAATAAATAAATAGAATTGCAAATGTACTTCCCATTGTTTTAGTATGTTCATGCGAGGGTTAAGCTTCATGGCTACCGTATGAACAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.60% 7.30% 0.04% 0.02% NA
All Indica  2759 88.10% 11.80% 0.04% 0.04% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 60.00% 39.80% 0.00% 0.22% NA
Indica III  913 95.80% 4.20% 0.00% 0.00% NA
Indica Intermediate  786 87.00% 13.00% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 86.70% 12.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0912313203 T -> DEL N N silent_mutation Average:35.745; most accessible tissue: Callus, score: 66.332 N N N N
vg0912313203 T -> A LOC_Os09g20450.1 downstream_gene_variant ; 3030.0bp to feature; MODIFIER silent_mutation Average:35.745; most accessible tissue: Callus, score: 66.332 N N N N
vg0912313203 T -> A LOC_Os09g20450-LOC_Os09g20460 intergenic_region ; MODIFIER silent_mutation Average:35.745; most accessible tissue: Callus, score: 66.332 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0912313203 NA 4.63E-08 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912313203 NA 1.51E-06 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912313203 NA 3.64E-06 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912313203 NA 5.81E-06 mr1717_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912313203 3.03E-06 1.00E-09 mr1895_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912313203 NA 1.40E-10 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251