Variant ID: vg0912313203 (JBrowse) | Variation Type: SNP |
Chromosome: chr09 | Position: 12313203 |
Reference Allele: T | Alternative Allele: A |
Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATTGTTCATACGGTAGCCATGAAGCTTAACCCTCGCATGAACATACTAAAACAATGGGAAGTACATTTGCAATTCTATTTATTTATTTATTTATTTAATT[T/A]
ATTTAGTTTATGCTACAAATTCTTATTGACAAGGATTAGCCTTGTGACACATTAAGTGGGTCTAACAATGATTTTAAGCTCTATGTAAATAAAATAAAAC
GTTTTATTTTATTTACATAGAGCTTAAAATCATTGTTAGACCCACTTAATGTGTCACAAGGCTAATCCTTGTCAATAAGAATTTGTAGCATAAACTAAAT[A/T]
AATTAAATAAATAAATAAATAAATAGAATTGCAAATGTACTTCCCATTGTTTTAGTATGTTCATGCGAGGGTTAAGCTTCATGGCTACCGTATGAACAAT
Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 92.60% | 7.30% | 0.04% | 0.02% | NA |
All Indica | 2759 | 88.10% | 11.80% | 0.04% | 0.04% | NA |
All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
Indica II | 465 | 60.00% | 39.80% | 0.00% | 0.22% | NA |
Indica III | 913 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 87.00% | 13.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
Intermediate | 90 | 86.70% | 12.20% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0912313203 | T -> DEL | N | N | silent_mutation | Average:35.745; most accessible tissue: Callus, score: 66.332 | N | N | N | N |
vg0912313203 | T -> A | LOC_Os09g20450.1 | downstream_gene_variant ; 3030.0bp to feature; MODIFIER | silent_mutation | Average:35.745; most accessible tissue: Callus, score: 66.332 | N | N | N | N |
vg0912313203 | T -> A | LOC_Os09g20450-LOC_Os09g20460 | intergenic_region ; MODIFIER | silent_mutation | Average:35.745; most accessible tissue: Callus, score: 66.332 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0912313203 | NA | 4.63E-08 | mr1557 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0912313203 | NA | 1.51E-06 | mr1598 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0912313203 | NA | 3.64E-06 | mr1944 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0912313203 | NA | 5.81E-06 | mr1717_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0912313203 | 3.03E-06 | 1.00E-09 | mr1895_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0912313203 | NA | 1.40E-10 | mr1895_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |