\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912300484:

Variant ID: vg0912300484 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 12300484
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.65, C: 0.37, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


AATTTTTATTTTGGTCATTTCTCCATCTGACTCTATTTAAATAATTTGAAATTTGAAATTCAAAGTTTGAAAAGTTAAAATAGAATTTTAGATCAGTGAA[C/T]
GACTTCAACTGAAAAAGTCATCAACAACAAAGTTGTATAACTCATCAAAATATATAACTTTTATTTTGGTCATTTTTCTATATAACATTTTTTGAACTGT

Reverse complement sequence

ACAGTTCAAAAAATGTTATATAGAAAAATGACCAAAATAAAAGTTATATATTTTGATGAGTTATACAACTTTGTTGTTGATGACTTTTTCAGTTGAAGTC[G/A]
TTCACTGATCTAAAATTCTATTTTAACTTTTCAAACTTTGAATTTCAAATTTCAAATTATTTAAATAGAGTCAGATGGAGAAATGACCAAAATAAAAATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.60% 36.20% 17.22% 0.00% NA
All Indica  2759 15.40% 58.10% 26.46% 0.00% NA
All Japonica  1512 95.20% 4.30% 0.53% 0.00% NA
Aus  269 72.10% 5.60% 22.30% 0.00% NA
Indica I  595 6.90% 85.00% 8.07% 0.00% NA
Indica II  465 20.00% 35.90% 44.09% 0.00% NA
Indica III  913 17.50% 50.60% 31.87% 0.00% NA
Indica Intermediate  786 16.70% 59.70% 23.66% 0.00% NA
Temperate Japonica  767 97.80% 1.80% 0.39% 0.00% NA
Tropical Japonica  504 90.50% 8.70% 0.79% 0.00% NA
Japonica Intermediate  241 96.70% 2.90% 0.41% 0.00% NA
VI/Aromatic  96 85.40% 8.30% 6.25% 0.00% NA
Intermediate  90 70.00% 18.90% 11.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0912300484 C -> T LOC_Os09g20440.1 upstream_gene_variant ; 2295.0bp to feature; MODIFIER silent_mutation Average:13.598; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0912300484 C -> T LOC_Os09g20440-LOC_Os09g20450 intergenic_region ; MODIFIER silent_mutation Average:13.598; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0912300484 NA 8.49E-08 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912300484 NA 2.11E-06 mr1346 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912300484 NA 1.08E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912300484 NA 3.80E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912300484 NA 2.15E-08 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912300484 NA 8.44E-06 mr1671 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912300484 NA 5.86E-07 mr1691 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912300484 NA 9.47E-07 mr1693 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912300484 NA 1.30E-06 mr1734 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912300484 NA 7.39E-06 mr1757 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912300484 6.13E-06 1.16E-07 mr1780 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912300484 NA 2.45E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912300484 NA 1.09E-06 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912300484 NA 7.54E-06 mr1887 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912300484 NA 6.71E-07 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251