Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0912275276:

Variant ID: vg0912275276 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 12275276
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

ACAATTTAGAATTAACTTAAATTCAAAATTTAAAATTTAAAGAATATCGAAAGATGAGTTTAGAGTCCACATAGAAATACAATTAGAAATAATAAAAATT[C/T]
AGAATTAAAAATAAATAATATTAGAAGAAGAGCCTAGAGTCCATATAGTAATATAATGTACAAATAAATAAATTTTGATATTAAAAATAATTAATAACTA

Reverse complement sequence

TAGTTATTAATTATTTTTAATATCAAAATTTATTTATTTGTACATTATATTACTATATGGACTCTAGGCTCTTCTTCTAATATTATTTATTTTTAATTCT[G/A]
AATTTTTATTATTTCTAATTGTATTTCTATGTGGACTCTAAACTCATCTTTCGATATTCTTTAAATTTTAAATTTTGAATTTAAGTTAATTCTAAATTGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.30%	31.40%	2.33%	0.99%	NA
All Indica	2759	46.00%	52.10%	1.16%	0.76%	NA
All Japonica	1512	91.40%	1.90%	4.96%	1.72%	NA
Aus	269	98.90%	0.70%	0.37%	0.00%	NA
Indica I	595	11.60%	85.20%	2.02%	1.18%	NA
Indica II	465	65.40%	31.40%	1.94%	1.29%	NA
Indica III	913	57.20%	42.20%	0.11%	0.55%	NA
Indica Intermediate	786	47.60%	50.80%	1.27%	0.38%	NA
Temperate Japonica	767	86.30%	1.40%	9.00%	3.26%	NA
Tropical Japonica	504	97.20%	2.40%	0.40%	0.00%	NA
Japonica Intermediate	241	95.40%	2.50%	1.66%	0.41%	NA
VI/Aromatic	96	92.70%	6.20%	1.04%	0.00%	NA
Intermediate	90	87.80%	11.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0912275276	C -> DEL	N	N	silent_mutation	Average:19.145; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0912275276	C -> T	LOC_Os09g20410.1	downstream_gene_variant ; 4519.0bp to feature; MODIFIER	silent_mutation	Average:19.145; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0912275276	C -> T	LOC_Os09g20400-LOC_Os09g20410	intergenic_region ; MODIFIER	silent_mutation	Average:19.145; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0912275276	NA	5.92E-09	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912275276	NA	1.78E-19	mr1598	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912275276	NA	6.39E-06	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912275276	NA	2.45E-06	mr1233_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912275276	5.19E-07	3.44E-35	mr1598_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912275276	9.96E-07	9.69E-11	mr1598_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251