\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912275276:

Variant ID: vg0912275276 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 12275276
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


ACAATTTAGAATTAACTTAAATTCAAAATTTAAAATTTAAAGAATATCGAAAGATGAGTTTAGAGTCCACATAGAAATACAATTAGAAATAATAAAAATT[C/T]
AGAATTAAAAATAAATAATATTAGAAGAAGAGCCTAGAGTCCATATAGTAATATAATGTACAAATAAATAAATTTTGATATTAAAAATAATTAATAACTA

Reverse complement sequence

TAGTTATTAATTATTTTTAATATCAAAATTTATTTATTTGTACATTATATTACTATATGGACTCTAGGCTCTTCTTCTAATATTATTTATTTTTAATTCT[G/A]
AATTTTTATTATTTCTAATTGTATTTCTATGTGGACTCTAAACTCATCTTTCGATATTCTTTAAATTTTAAATTTTGAATTTAAGTTAATTCTAAATTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.30% 31.40% 2.33% 0.99% NA
All Indica  2759 46.00% 52.10% 1.16% 0.76% NA
All Japonica  1512 91.40% 1.90% 4.96% 1.72% NA
Aus  269 98.90% 0.70% 0.37% 0.00% NA
Indica I  595 11.60% 85.20% 2.02% 1.18% NA
Indica II  465 65.40% 31.40% 1.94% 1.29% NA
Indica III  913 57.20% 42.20% 0.11% 0.55% NA
Indica Intermediate  786 47.60% 50.80% 1.27% 0.38% NA
Temperate Japonica  767 86.30% 1.40% 9.00% 3.26% NA
Tropical Japonica  504 97.20% 2.40% 0.40% 0.00% NA
Japonica Intermediate  241 95.40% 2.50% 1.66% 0.41% NA
VI/Aromatic  96 92.70% 6.20% 1.04% 0.00% NA
Intermediate  90 87.80% 11.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0912275276 C -> DEL N N silent_mutation Average:19.145; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0912275276 C -> T LOC_Os09g20410.1 downstream_gene_variant ; 4519.0bp to feature; MODIFIER silent_mutation Average:19.145; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0912275276 C -> T LOC_Os09g20400-LOC_Os09g20410 intergenic_region ; MODIFIER silent_mutation Average:19.145; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0912275276 NA 5.92E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912275276 NA 1.78E-19 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912275276 NA 6.39E-06 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912275276 NA 2.45E-06 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912275276 5.19E-07 3.44E-35 mr1598_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912275276 9.96E-07 9.69E-11 mr1598_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251