\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912193101:

Variant ID: vg0912193101 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 12193101
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.07, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTAGAGAAACTTCCATATAGAAAGTTTTCGCACGAAACACATCGTTTAGCAGTTTGAAAAATATGTCGTGAATACTCCCTCCATTTAATATTATAAGT[T/C]
GTTTTAAACTTTGTTAAGTTTGATCAAGTTTATAAAAAAATTAACAACATCTAAAATATCAAATTTGTTTCATTAAATTTAACATTGAATTCGTGTTGAA

Reverse complement sequence

TTCAACACGAATTCAATGTTAAATTTAATGAAACAAATTTGATATTTTAGATGTTGTTAATTTTTTTATAAACTTGATCAAACTTAACAAAGTTTAAAAC[A/G]
ACTTATAATATTAAATGGAGGGAGTATTCACGACATATTTTTCAAACTGCTAAACGATGTGTTTCGTGCGAAAACTTTCTATATGGAAGTTTCTCTAAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.70% 48.10% 0.21% 0.00% NA
All Indica  2759 27.40% 72.40% 0.18% 0.00% NA
All Japonica  1512 97.00% 2.80% 0.13% 0.00% NA
Aus  269 32.00% 67.70% 0.37% 0.00% NA
Indica I  595 7.40% 92.40% 0.17% 0.00% NA
Indica II  465 54.20% 45.60% 0.22% 0.00% NA
Indica III  913 25.70% 74.30% 0.00% 0.00% NA
Indica Intermediate  786 28.60% 71.00% 0.38% 0.00% NA
Temperate Japonica  767 96.20% 3.50% 0.26% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 94.20% 5.80% 0.00% 0.00% NA
VI/Aromatic  96 70.80% 29.20% 0.00% 0.00% NA
Intermediate  90 75.60% 22.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0912193101 T -> C LOC_Os09g20330.1 upstream_gene_variant ; 3040.0bp to feature; MODIFIER silent_mutation Average:18.385; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0912193101 T -> C LOC_Os09g20310.1 downstream_gene_variant ; 2538.0bp to feature; MODIFIER silent_mutation Average:18.385; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0912193101 T -> C LOC_Os09g20320.1 intron_variant ; MODIFIER silent_mutation Average:18.385; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0912193101 NA 4.16E-15 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 1.09E-06 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 2.66E-16 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 1.36E-16 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 9.85E-06 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 4.27E-07 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 2.41E-06 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 8.89E-10 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 6.48E-10 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 3.32E-06 1.22E-10 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 3.74E-16 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 6.50E-08 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 2.50E-06 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 3.18E-06 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 4.91E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 1.12E-14 mr1667 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 1.41E-15 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 2.75E-06 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 1.25E-15 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 2.63E-06 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 1.68E-15 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 4.38E-10 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 2.69E-06 3.75E-08 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 1.40E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 4.44E-08 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 2.74E-06 2.94E-08 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 1.73E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 1.91E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 8.46E-06 mr1497_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 1.57E-07 3.29E-10 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 5.67E-07 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 5.99E-14 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 2.96E-15 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 2.81E-07 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 2.00E-09 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 1.57E-07 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 1.12E-06 8.16E-10 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 5.52E-09 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912193101 NA 5.52E-09 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251