\
| Variant ID: vg0912172576 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 12172576 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTTTTTAAGAGAACAATACGGAAGGTTTATATCCGGTATGTACATTAATTTTTCTGGTATAATTTCGATGAAGCTGGGACTTTTCTAAATAGATCTAAT[C/T]
TAATAGTCTAAAACAGTGGGTCCACCAATTTAAGTGAAAATCGACGGTTAGATTAAAAGTGCCATGTGACGGTTTAGGAGCGTTTGTAGGAGTGCCACGT
ACGTGGCACTCCTACAAACGCTCCTAAACCGTCACATGGCACTTTTAATCTAACCGTCGATTTTCACTTAAATTGGTGGACCCACTGTTTTAGACTATTA[G/A]
ATTAGATCTATTTAGAAAAGTCCCAGCTTCATCGAAATTATACCAGAAAAATTAATGTACATACCGGATATAAACCTTCCGTATTGTTCTCTTAAAAAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.40% | 10.90% | 0.66% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 65.30% | 32.80% | 1.85% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 96.70% | 2.60% | 0.65% | 0.00% | NA |
| Tropical Japonica | 504 | 23.20% | 73.40% | 3.37% | 0.00% | NA |
| Japonica Intermediate | 241 | 53.50% | 44.00% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 14.40% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0912172576 | C -> T | LOC_Os09g20284.1 | intron_variant ; MODIFIER | silent_mutation | Average:40.862; most accessible tissue: Zhenshan97 flower, score: 61.362 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0912172576 | 2.49E-06 | NA | mr1018 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | 6.57E-06 | NA | mr1019 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 9.87E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 1.51E-08 | mr1552 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | 4.37E-08 | NA | mr1019_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 2.55E-23 | mr1042_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 1.63E-07 | mr1042_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | 4.13E-06 | NA | mr1055_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 2.69E-08 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 2.33E-07 | mr1206_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | 5.15E-07 | NA | mr1261_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 2.49E-06 | mr1269_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 6.74E-07 | mr1289_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 1.03E-06 | mr1363_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 4.27E-07 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 8.88E-08 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 3.80E-07 | mr1419_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 7.06E-07 | mr1420_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 2.11E-08 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 5.65E-07 | mr1467_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 1.84E-06 | mr1470_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 8.54E-08 | mr1479_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 9.50E-08 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 4.84E-06 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 6.43E-10 | mr1502_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 8.68E-08 | mr1502_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 1.30E-09 | mr1506_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 1.38E-09 | mr1543_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 4.91E-06 | mr1544_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 9.34E-06 | mr1544_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 1.87E-07 | mr1556_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 9.21E-08 | mr1582_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 2.06E-06 | mr1596_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 2.77E-11 | mr1646_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 6.56E-06 | mr1665_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 5.12E-14 | mr1680_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 4.92E-07 | mr1680_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 2.95E-08 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 5.03E-06 | mr1687_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 1.71E-15 | mr1742_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 8.21E-07 | mr1764_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 3.90E-06 | mr1779_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 5.60E-06 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 3.75E-06 | mr1812_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 6.22E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 6.94E-06 | mr1833_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 2.65E-27 | mr1871_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 7.38E-09 | mr1871_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0912172576 | NA | 8.98E-06 | mr1984_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |