\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912061274:

Variant ID: vg0912061274 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 12061274
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACAAGGACCTGGGGTACGATTGCATGCAAGAGGAGCTTGACGCTTATGTGGCATCAGAAGTCAGGAGACAATTGAAGCCTCGAAGTCCAGAAAAGAAGA[T/C]
TCCTATAGACCCGAGTGTCAGGAACTTCTTCAGGGGTATGTCTGCACCTGCCAAGGAGGCCATAAAGCTATCAGACTATGAGCGAACACTTAAGAAAGCA

Reverse complement sequence

TGCTTTCTTAAGTGTTCGCTCATAGTCTGATAGCTTTATGGCCTCCTTGGCAGGTGCAGACATACCCCTGAAGAAGTTCCTGACACTCGGGTCTATAGGA[A/G]
TCTTCTTTTCTGGACTTCGAGGCTTCAATTGTCTCCTGACTTCTGATGCCACATAAGCGTCAAGCTCCTCTTGCATGCAATCGTACCCCAGGTCCTTGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.80% 1.50% 0.85% 13.88% NA
All Indica  2759 76.80% 0.00% 0.98% 22.15% NA
All Japonica  1512 95.00% 4.40% 0.53% 0.13% NA
Aus  269 88.10% 0.00% 0.37% 11.52% NA
Indica I  595 85.40% 0.00% 0.84% 13.78% NA
Indica II  465 93.10% 0.00% 0.22% 6.67% NA
Indica III  913 62.30% 0.00% 1.31% 36.36% NA
Indica Intermediate  786 77.60% 0.10% 1.15% 21.12% NA
Temperate Japonica  767 99.70% 0.00% 0.13% 0.13% NA
Tropical Japonica  504 86.10% 12.50% 1.39% 0.00% NA
Japonica Intermediate  241 98.30% 1.20% 0.00% 0.41% NA
VI/Aromatic  96 89.60% 0.00% 1.04% 9.38% NA
Intermediate  90 90.00% 3.30% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0912061274 T -> DEL LOC_Os09g20130.1 N frameshift_variant Average:43.711; most accessible tissue: Zhenshan97 flower, score: 65.596 N N N N
vg0912061274 T -> C LOC_Os09g20130.1 missense_variant ; p.Ile215Thr; MODERATE nonsynonymous_codon ; I215T Average:43.711; most accessible tissue: Zhenshan97 flower, score: 65.596 possibly damaging 1.721 DELETERIOUS 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0912061274 NA 7.64E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912061274 NA 9.59E-09 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912061274 NA 7.61E-06 mr1107 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912061274 7.94E-07 7.94E-07 mr1204 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912061274 NA 1.02E-08 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912061274 5.77E-14 5.77E-14 mr1076_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912061274 NA 8.28E-08 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912061274 1.82E-08 1.61E-13 mr1083_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912061274 5.48E-08 1.98E-08 mr1085_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912061274 1.77E-06 6.60E-09 mr1103_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912061274 6.02E-07 7.03E-10 mr1104_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912061274 NA 9.14E-08 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912061274 2.28E-08 2.28E-08 mr1145_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912061274 8.66E-07 NA mr1155_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912061274 3.23E-07 5.28E-12 mr1226_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912061274 1.86E-07 9.25E-11 mr1408_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912061274 5.06E-06 1.71E-06 mr1437_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251