Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912040576:

Variant ID: vg0912040576 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 12040576
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAAGATGTATGGTTGTTCCGCATCCCAGAATTAGATAGATGTGCGCACTTTAATTCTGGGTTTTCATCTTCATGATGAACCTCTTCATGAGGCAATTCAC[C/T]
TTCATGATGATTACTCTACAAGAGTTGTAAGGAGTTATTAATGGGTACATTGACAATAGTCATTAGATCTTAGAATCCGCAGGCGTCCCCGTAGATTTTA

Reverse complement sequence

TAAAATCTACGGGGACGCCTGCGGATTCTAAGATCTAATGACTATTGTCAATGTACCCATTAATAACTCCTTACAACTCTTGTAGAGTAATCATCATGAA[G/A]
GTGAATTGCCTCATGAAGAGGTTCATCATGAAGATGAAAACCCAGAATTAAAGTGCGCACATCTATCTAATTCTGGGATGCGGAACAACCATACATCTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.30%	3.10%	17.50%	0.11%	NA
All Indica	2759	65.60%	5.10%	29.10%	0.18%	NA
All Japonica	1512	99.50%	0.00%	0.53%	0.00%	NA
Aus	269	97.40%	1.10%	1.49%	0.00%	NA
Indica I	595	77.50%	2.50%	20.00%	0.00%	NA
Indica II	465	89.70%	0.90%	9.25%	0.22%	NA
Indica III	913	45.10%	10.40%	44.03%	0.44%	NA
Indica Intermediate	786	66.20%	3.40%	30.41%	0.00%	NA
Temperate Japonica	767	99.70%	0.00%	0.26%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	97.90%	0.00%	2.07%	0.00%	NA
VI/Aromatic	96	92.70%	0.00%	7.29%	0.00%	NA
Intermediate	90	93.30%	1.10%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0912040576	C -> DEL	N	N	silent_mutation	Average:23.612; most accessible tissue: Zhenshan97 root, score: 32.766	N	N	N	N
vg0912040576	C -> T	LOC_Os09g20100.1	upstream_gene_variant ; 3495.0bp to feature; MODIFIER	silent_mutation	Average:23.612; most accessible tissue: Zhenshan97 root, score: 32.766	N	N	N	N
vg0912040576	C -> T	LOC_Os09g20090-LOC_Os09g20100	intergenic_region ; MODIFIER	silent_mutation	Average:23.612; most accessible tissue: Zhenshan97 root, score: 32.766	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0912040576	NA	3.38E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912040576	4.94E-06	NA	mr1189	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912040576	NA	8.80E-06	mr1502	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912040576	NA	3.18E-06	mr1919	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251