Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0912023386:

Variant ID: vg0912023386 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 12023386
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

TATATATCATATGGATTCGTTAAGTCTTTCATGTATTGAGTAAGTTCACGGTTACCGTTATGTGGTCGACGGCGCTGTCGACCGATGTTGGATTTTCCGC[T/C]
AACTCAGTTGATGCGCAACTGCTGCGTTTTTGGGTGGGACTTCCTAACTCTTCGTGCGCAGCAGCAGCGGCGGCCTGGGGGTTCTATTGCTCTTCTCGGA

Reverse complement sequence

TCCGAGAAGAGCAATAGAACCCCCAGGCCGCCGCTGCTGCTGCGCACGAAGAGTTAGGAAGTCCCACCCAAAAACGCAGCAGTTGCGCATCAACTGAGTT[A/G]
GCGGAAAATCCAACATCGGTCGACAGCGCCGTCGACCACATAACGGTAACCGTGAACTTACTCAATACATGAAAGACTTAACGAATCCATATGATATATA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.20%	0.40%	43.97%	0.42%	NA
All Indica	2759	33.20%	0.60%	65.53%	0.65%	NA
All Japonica	1512	99.30%	0.00%	0.66%	0.07%	NA
Aus	269	13.00%	0.40%	86.62%	0.00%	NA
Indica I	595	17.00%	1.30%	79.83%	1.85%	NA
Indica II	465	61.90%	0.00%	37.63%	0.43%	NA
Indica III	913	25.70%	0.20%	73.93%	0.11%	NA
Indica Intermediate	786	37.30%	0.80%	61.45%	0.51%	NA
Temperate Japonica	767	99.60%	0.00%	0.26%	0.13%	NA
Tropical Japonica	504	99.60%	0.00%	0.40%	0.00%	NA
Japonica Intermediate	241	97.50%	0.00%	2.49%	0.00%	NA
VI/Aromatic	96	85.40%	0.00%	14.58%	0.00%	NA
Intermediate	90	84.40%	0.00%	14.44%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0912023386	T -> DEL	N	N	silent_mutation	Average:14.043; most accessible tissue: Zhenshan97 root, score: 22.162	N	N	N	N
vg0912023386	T -> C	LOC_Os09g20060.1	upstream_gene_variant ; 166.0bp to feature; MODIFIER	silent_mutation	Average:14.043; most accessible tissue: Zhenshan97 root, score: 22.162	N	N	N	N
vg0912023386	T -> C	LOC_Os09g20070.1	downstream_gene_variant ; 84.0bp to feature; MODIFIER	silent_mutation	Average:14.043; most accessible tissue: Zhenshan97 root, score: 22.162	N	N	N	N
vg0912023386	T -> C	LOC_Os09g20080.1	downstream_gene_variant ; 3152.0bp to feature; MODIFIER	silent_mutation	Average:14.043; most accessible tissue: Zhenshan97 root, score: 22.162	N	N	N	N
vg0912023386	T -> C	LOC_Os09g20060-LOC_Os09g20070	intergenic_region ; MODIFIER	silent_mutation	Average:14.043; most accessible tissue: Zhenshan97 root, score: 22.162	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0912023386	NA	1.94E-21	mr1168	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912023386	NA	7.44E-07	mr1209	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912023386	NA	5.37E-07	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912023386	NA	1.91E-10	mr1272	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912023386	NA	4.80E-09	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912023386	NA	1.21E-10	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912023386	NA	8.26E-07	mr1378	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912023386	NA	2.30E-06	mr1397	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912023386	NA	6.25E-09	mr1425	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912023386	NA	2.27E-07	mr1425	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912023386	NA	6.71E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912023386	NA	8.34E-06	mr1511	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912023386	NA	5.46E-08	mr1514	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912023386	NA	1.20E-13	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912023386	NA	8.62E-08	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912023386	NA	3.73E-06	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912023386	NA	3.67E-07	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912023386	NA	1.49E-07	mr1680	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912023386	NA	6.32E-07	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912023386	NA	9.42E-06	mr1832	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912023386	NA	6.23E-09	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912023386	NA	7.11E-19	mr1168_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912023386	NA	1.48E-13	mr1717_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912023386	1.93E-06	1.22E-08	mr1717_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912023386	NA	1.30E-10	mr1893_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912023386	NA	2.77E-07	mr1895_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0912023386	NA	1.81E-06	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251