Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0911981636:

Variant ID: vg0911981636 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 11981636
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATCTAGATTCATTAACATCAATATGAACGTGGGAAATGTAAGAATGACTTACATTGTGAAACGTATATGTCTAGATCCATTAATATCAATATGAATGTAG[G/T]
AAATACTAGAATGACTTACATTGTGAAACCGAGGAAGTAATGAATAAAATGGCGGGTTAATGTGATACGCTTCCCAAGTTTATAAACGGCGCGGTTTTCG

Reverse complement sequence

CGAAAACCGCGCCGTTTATAAACTTGGGAAGCGTATCACATTAACCCGCCATTTTATTCATTACTTCCTCGGTTTCACAATGTAAGTCATTCTAGTATTT[C/A]
CTACATTCATATTGATATTAATGGATCTAGACATATACGTTTCACAATGTAAGTCATTCTTACATTTCCCACGTTCATATTGATGTTAATGAATCTAGAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.40%	2.80%	0.76%	23.06%	NA
All Indica	2759	60.60%	0.10%	0.40%	38.96%	NA
All Japonica	1512	89.60%	8.40%	1.52%	0.53%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	73.40%	0.00%	0.17%	26.39%	NA
Indica II	465	81.70%	0.00%	0.43%	17.85%	NA
Indica III	913	42.50%	0.00%	0.55%	56.96%	NA
Indica Intermediate	786	59.30%	0.30%	0.38%	40.08%	NA
Temperate Japonica	767	98.40%	0.30%	0.91%	0.39%	NA
Tropical Japonica	504	73.00%	24.00%	2.78%	0.20%	NA
Japonica Intermediate	241	95.90%	1.70%	0.83%	1.66%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	87.80%	4.40%	2.22%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0911981636	G -> DEL	N	N	silent_mutation	Average:30.577; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0911981636	G -> T	LOC_Os09g20010.1	upstream_gene_variant ; 4335.0bp to feature; MODIFIER	silent_mutation	Average:30.577; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0911981636	G -> T	LOC_Os09g20010.2	upstream_gene_variant ; 4338.0bp to feature; MODIFIER	silent_mutation	Average:30.577; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0911981636	G -> T	LOC_Os09g20000.1	downstream_gene_variant ; 3612.0bp to feature; MODIFIER	silent_mutation	Average:30.577; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0911981636	G -> T	LOC_Os09g20000-LOC_Os09g20010	intergenic_region ; MODIFIER	silent_mutation	Average:30.577; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0911981636	NA	9.24E-07	mr1073	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636	4.43E-06	1.45E-07	mr1215	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636	NA	1.20E-07	mr1217	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636	NA	4.25E-06	mr1218	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636	NA	5.56E-06	mr1294	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636	NA	1.24E-06	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636	NA	3.12E-06	mr1382	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636	NA	1.53E-06	mr1398	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636	NA	4.34E-06	mr1414	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636	NA	3.56E-08	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636	3.96E-07	4.98E-11	mr1583	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636	NA	2.73E-07	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636	NA	7.82E-07	mr1700	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636	NA	2.81E-06	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636	NA	7.61E-06	mr1072_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636	NA	6.48E-06	mr1075_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636	NA	6.30E-06	mr1929_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251