\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0911981636:

Variant ID: vg0911981636 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 11981636
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCTAGATTCATTAACATCAATATGAACGTGGGAAATGTAAGAATGACTTACATTGTGAAACGTATATGTCTAGATCCATTAATATCAATATGAATGTAG[G/T]
AAATACTAGAATGACTTACATTGTGAAACCGAGGAAGTAATGAATAAAATGGCGGGTTAATGTGATACGCTTCCCAAGTTTATAAACGGCGCGGTTTTCG

Reverse complement sequence

CGAAAACCGCGCCGTTTATAAACTTGGGAAGCGTATCACATTAACCCGCCATTTTATTCATTACTTCCTCGGTTTCACAATGTAAGTCATTCTAGTATTT[C/A]
CTACATTCATATTGATATTAATGGATCTAGACATATACGTTTCACAATGTAAGTCATTCTTACATTTCCCACGTTCATATTGATGTTAATGAATCTAGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.40% 2.80% 0.76% 23.06% NA
All Indica  2759 60.60% 0.10% 0.40% 38.96% NA
All Japonica  1512 89.60% 8.40% 1.52% 0.53% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 73.40% 0.00% 0.17% 26.39% NA
Indica II  465 81.70% 0.00% 0.43% 17.85% NA
Indica III  913 42.50% 0.00% 0.55% 56.96% NA
Indica Intermediate  786 59.30% 0.30% 0.38% 40.08% NA
Temperate Japonica  767 98.40% 0.30% 0.91% 0.39% NA
Tropical Japonica  504 73.00% 24.00% 2.78% 0.20% NA
Japonica Intermediate  241 95.90% 1.70% 0.83% 1.66% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 87.80% 4.40% 2.22% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0911981636 G -> DEL N N silent_mutation Average:30.577; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0911981636 G -> T LOC_Os09g20010.1 upstream_gene_variant ; 4335.0bp to feature; MODIFIER silent_mutation Average:30.577; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0911981636 G -> T LOC_Os09g20010.2 upstream_gene_variant ; 4338.0bp to feature; MODIFIER silent_mutation Average:30.577; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0911981636 G -> T LOC_Os09g20000.1 downstream_gene_variant ; 3612.0bp to feature; MODIFIER silent_mutation Average:30.577; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0911981636 G -> T LOC_Os09g20000-LOC_Os09g20010 intergenic_region ; MODIFIER silent_mutation Average:30.577; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0911981636 NA 9.24E-07 mr1073 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636 4.43E-06 1.45E-07 mr1215 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636 NA 1.20E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636 NA 4.25E-06 mr1218 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636 NA 5.56E-06 mr1294 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636 NA 1.24E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636 NA 3.12E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636 NA 1.53E-06 mr1398 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636 NA 4.34E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636 NA 3.56E-08 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636 3.96E-07 4.98E-11 mr1583 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636 NA 2.73E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636 NA 7.82E-07 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636 NA 2.81E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636 NA 7.61E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636 NA 6.48E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911981636 NA 6.30E-06 mr1929_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251