\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0911953487:

Variant ID: vg0911953487 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 11953487
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTTTCTATTTCTTCATCACATATTATAGTCTACAGTAAATAGTTAAATTGGTAAATATATATAAAAAATCCACTTTACTCCCATGAACTATTTTGA[C/T]
GAAGCACTTAACCGGTTAACCCCCCAAATGCTTTTTCATCTCGTTTTATACCCCCGAACTATTAAAAGTGGTTCCCCTTAGTGCCTCAATATTTCTCTTT

Reverse complement sequence

AAAGAGAAATATTGAGGCACTAAGGGGAACCACTTTTAATAGTTCGGGGGTATAAAACGAGATGAAAAAGCATTTGGGGGGTTAACCGGTTAAGTGCTTC[G/A]
TCAAAATAGTTCATGGGAGTAAAGTGGATTTTTTATATATATTTACCAATTTAACTATTTACTGTAGACTATAATATGTGATGAAGAAATAGAAAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.80% 4.20% 0.00% 0.00% NA
All Indica  2759 92.90% 7.10% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 87.80% 12.20% 0.00% 0.00% NA
Indica Intermediate  786 92.90% 7.10% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0911953487 C -> T LOC_Os09g19960.1 upstream_gene_variant ; 984.0bp to feature; MODIFIER silent_mutation Average:30.845; most accessible tissue: Callus, score: 54.171 N N N N
vg0911953487 C -> T LOC_Os09g19970.1 upstream_gene_variant ; 2443.0bp to feature; MODIFIER silent_mutation Average:30.845; most accessible tissue: Callus, score: 54.171 N N N N
vg0911953487 C -> T LOC_Os09g19980.1 upstream_gene_variant ; 4541.0bp to feature; MODIFIER silent_mutation Average:30.845; most accessible tissue: Callus, score: 54.171 N N N N
vg0911953487 C -> T LOC_Os09g19952.1 downstream_gene_variant ; 4286.0bp to feature; MODIFIER silent_mutation Average:30.845; most accessible tissue: Callus, score: 54.171 N N N N
vg0911953487 C -> T LOC_Os09g19954.1 downstream_gene_variant ; 2419.0bp to feature; MODIFIER silent_mutation Average:30.845; most accessible tissue: Callus, score: 54.171 N N N N
vg0911953487 C -> T LOC_Os09g19960-LOC_Os09g19970 intergenic_region ; MODIFIER silent_mutation Average:30.845; most accessible tissue: Callus, score: 54.171 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0911953487 6.37E-07 1.67E-07 mr1113 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251