\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0911617740:

Variant ID: vg0911617740 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 11617740
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATACTCTTGCACTATGTAAGTACACTTAAGTACGTACACTGAGAGAGAGAGAATGTTCGTTATTTCTATATCGCTCCAAGGCCGAACATAGGCATGTTA[T/A]
TTTACAAATCTAATCTTACTGTGTGACATGCATACTGGATCCAACAGCTTTAGTTGAAATCAACGAACAGATCTTTTTCATTTTTTTTTCTGATAACTTG

Reverse complement sequence

CAAGTTATCAGAAAAAAAAATGAAAAAGATCTGTTCGTTGATTTCAACTAAAGCTGTTGGATCCAGTATGCATGTCACACAGTAAGATTAGATTTGTAAA[A/T]
TAACATGCCTATGTTCGGCCTTGGAGCGATATAGAAATAACGAACATTCTCTCTCTCTCAGTGTACGTACTTAAGTGTACTTACATAGTGCAAGAGTATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.30% 7.10% 29.75% 4.89% NA
All Indica  2759 38.90% 12.10% 41.65% 7.43% NA
All Japonica  1512 97.70% 0.00% 1.85% 0.46% NA
Aus  269 20.40% 0.00% 75.84% 3.72% NA
Indica I  595 65.90% 9.10% 21.34% 3.70% NA
Indica II  465 32.70% 10.30% 39.78% 17.20% NA
Indica III  913 28.00% 15.30% 51.81% 4.82% NA
Indica Intermediate  786 34.60% 11.60% 46.31% 7.51% NA
Temperate Japonica  767 99.30% 0.00% 0.39% 0.26% NA
Tropical Japonica  504 95.00% 0.00% 4.17% 0.79% NA
Japonica Intermediate  241 97.90% 0.00% 1.66% 0.41% NA
VI/Aromatic  96 89.60% 0.00% 9.38% 1.04% NA
Intermediate  90 72.20% 1.10% 17.78% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0911617740 T -> DEL N N silent_mutation Average:16.494; most accessible tissue: Zhenshan97 flower, score: 31.8 N N N N
vg0911617740 T -> A LOC_Os09g19400.1 upstream_gene_variant ; 990.0bp to feature; MODIFIER silent_mutation Average:16.494; most accessible tissue: Zhenshan97 flower, score: 31.8 N N N N
vg0911617740 T -> A LOC_Os09g19400-LOC_Os09g19420 intergenic_region ; MODIFIER silent_mutation Average:16.494; most accessible tissue: Zhenshan97 flower, score: 31.8 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0911617740 NA 1.50E-07 mr1006 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911617740 NA 1.22E-08 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911617740 NA 1.17E-06 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911617740 NA 8.60E-08 mr1007 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911617740 NA 2.34E-07 mr1052 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911617740 NA 1.42E-08 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911617740 NA 2.76E-08 mr1006_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911617740 NA 2.00E-08 mr1006_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911617740 NA 8.76E-06 mr1471_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251