\
| Variant ID: vg0911617740 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 11617740 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TATACTCTTGCACTATGTAAGTACACTTAAGTACGTACACTGAGAGAGAGAGAATGTTCGTTATTTCTATATCGCTCCAAGGCCGAACATAGGCATGTTA[T/A]
TTTACAAATCTAATCTTACTGTGTGACATGCATACTGGATCCAACAGCTTTAGTTGAAATCAACGAACAGATCTTTTTCATTTTTTTTTCTGATAACTTG
CAAGTTATCAGAAAAAAAAATGAAAAAGATCTGTTCGTTGATTTCAACTAAAGCTGTTGGATCCAGTATGCATGTCACACAGTAAGATTAGATTTGTAAA[A/T]
TAACATGCCTATGTTCGGCCTTGGAGCGATATAGAAATAACGAACATTCTCTCTCTCTCAGTGTACGTACTTAAGTGTACTTACATAGTGCAAGAGTATA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.30% | 7.10% | 29.75% | 4.89% | NA |
| All Indica | 2759 | 38.90% | 12.10% | 41.65% | 7.43% | NA |
| All Japonica | 1512 | 97.70% | 0.00% | 1.85% | 0.46% | NA |
| Aus | 269 | 20.40% | 0.00% | 75.84% | 3.72% | NA |
| Indica I | 595 | 65.90% | 9.10% | 21.34% | 3.70% | NA |
| Indica II | 465 | 32.70% | 10.30% | 39.78% | 17.20% | NA |
| Indica III | 913 | 28.00% | 15.30% | 51.81% | 4.82% | NA |
| Indica Intermediate | 786 | 34.60% | 11.60% | 46.31% | 7.51% | NA |
| Temperate Japonica | 767 | 99.30% | 0.00% | 0.39% | 0.26% | NA |
| Tropical Japonica | 504 | 95.00% | 0.00% | 4.17% | 0.79% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.00% | 1.66% | 0.41% | NA |
| VI/Aromatic | 96 | 89.60% | 0.00% | 9.38% | 1.04% | NA |
| Intermediate | 90 | 72.20% | 1.10% | 17.78% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0911617740 | T -> DEL | N | N | silent_mutation | Average:16.494; most accessible tissue: Zhenshan97 flower, score: 31.8 | N | N | N | N |
| vg0911617740 | T -> A | LOC_Os09g19400.1 | upstream_gene_variant ; 990.0bp to feature; MODIFIER | silent_mutation | Average:16.494; most accessible tissue: Zhenshan97 flower, score: 31.8 | N | N | N | N |
| vg0911617740 | T -> A | LOC_Os09g19400-LOC_Os09g19420 | intergenic_region ; MODIFIER | silent_mutation | Average:16.494; most accessible tissue: Zhenshan97 flower, score: 31.8 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0911617740 | NA | 1.50E-07 | mr1006 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911617740 | NA | 1.22E-08 | mr1006 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911617740 | NA | 1.17E-06 | mr1007 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911617740 | NA | 8.60E-08 | mr1007 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911617740 | NA | 2.34E-07 | mr1052 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911617740 | NA | 1.42E-08 | mr1052 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911617740 | NA | 2.76E-08 | mr1006_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911617740 | NA | 2.00E-08 | mr1006_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911617740 | NA | 8.76E-06 | mr1471_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |