Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0911597491:

Variant ID: vg0911597491 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 11597491
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCAATTGTGGTGCTGGAGGCAATGGCACTGGAGGAGGAGGCAAGAACTGTAACACTAATAGAGGCATCAACACCAACACTACCTCATATAGTACCGGAGC[G/A]
TTCTCTAGGTATGTTACCTTCATCACTATAGTGTTAAACATGTTTCTTGATGATGCTTATCTAGTTATTAGCACGTTCATGTTTAGCACTATCACGGGAT

Reverse complement sequence

ATCCCGTGATAGTGCTAAACATGAACGTGCTAATAACTAGATAAGCATCATCAAGAAACATGTTTAACACTATAGTGATGAAGGTAACATACCTAGAGAA[C/T]
GCTCCGGTACTATATGAGGTAGTGTTGGTGTTGATGCCTCTATTAGTGTTACAGTTCTTGCCTCCTCCTCCAGTGCCATTGCCTCCAGCACCACAATTGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.40% 1.30% 1.18% 14.13% NA
All Indica  2759 78.90% 0.10% 1.38% 19.64% NA
All Japonica  1512 94.70% 2.80% 0.99% 1.52% NA
Aus  269 64.30% 4.10% 0.37% 31.23% NA
Indica I  595 95.30% 0.00% 0.50% 4.20% NA
Indica II  465 71.00% 0.20% 1.94% 26.88% NA
Indica III  913 70.00% 0.00% 1.42% 28.59% NA
Indica Intermediate  786 81.40% 0.30% 1.65% 16.67% NA
Temperate Japonica  767 96.60% 2.20% 0.78% 0.39% NA
Tropical Japonica  504 95.00% 0.80% 0.99% 3.17% NA
Japonica Intermediate  241 88.00% 8.70% 1.66% 1.66% NA
VI/Aromatic  96 92.70% 2.10% 1.04% 4.17% NA
Intermediate  90 80.00% 2.20% 1.11% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0911597491 G -> DEL N N silent_mutation Average:55.6; most accessible tissue: Minghui63 flag leaf, score: 87.461 N N N N
vg0911597491 G -> A LOC_Os09g19370.1 downstream_gene_variant ; 579.0bp to feature; MODIFIER silent_mutation Average:55.6; most accessible tissue: Minghui63 flag leaf, score: 87.461 N N N N
vg0911597491 G -> A LOC_Os09g19380.1 downstream_gene_variant ; 4729.0bp to feature; MODIFIER silent_mutation Average:55.6; most accessible tissue: Minghui63 flag leaf, score: 87.461 N N N N
vg0911597491 G -> A LOC_Os09g19360-LOC_Os09g19370 intergenic_region ; MODIFIER silent_mutation Average:55.6; most accessible tissue: Minghui63 flag leaf, score: 87.461 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0911597491 G A -0.02 -0.03 -0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0911597491 2.87E-06 NA mr1078 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911597491 2.28E-07 1.13E-06 mr1080 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911597491 3.10E-06 3.10E-06 mr1141 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911597491 2.40E-06 5.37E-06 mr1203 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911597491 9.74E-06 8.14E-06 mr1618 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251