Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0911386408:

Variant ID: vg0911386408 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 11386408
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.58, T: 0.42, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:

TCATAAAAGTTTGACTAGAACGGCAAACCCGAGTAGAAGATTGAAACCGTCGAACTCATTGAGATCGATCTCGGCACATCTCTAGAAATTGATTCCATCG[T/C]
ACTTCTCGATGGAAAGCTCGACGCACCCCTACCTGGCGCGCCAACTGTCGAAACAATATTTCAGCAATATAGAGGGGTAGCGCACGAGACCTAAAAGTAG

Reverse complement sequence

CTACTTTTAGGTCTCGTGCGCTACCCCTCTATATTGCTGAAATATTGTTTCGACAGTTGGCGCGCCAGGTAGGGGTGCGTCGAGCTTTCCATCGAGAAGT[A/G]
CGATGGAATCAATTTCTAGAGATGTGCCGAGATCGATCTCAATGAGTTCGACGGTTTCAATCTTCTACTCGGGTTTGCCGTTCTAGTCAAACTTTTATGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	26.40%	8.10%	0.68%	64.75%	NA
All Indica	2759	3.30%	12.40%	0.76%	83.54%	NA
All Japonica	1512	72.20%	1.70%	0.20%	25.86%	NA
Aus	269	7.10%	3.00%	0.74%	89.22%	NA
Indica I	595	5.50%	10.40%	0.50%	83.53%	NA
Indica II	465	4.50%	4.50%	1.29%	89.68%	NA
Indica III	913	0.90%	18.40%	0.33%	80.39%	NA
Indica Intermediate	786	3.80%	11.50%	1.15%	83.59%	NA
Temperate Japonica	767	67.50%	0.30%	0.13%	32.07%	NA
Tropical Japonica	504	80.80%	4.60%	0.00%	14.68%	NA
Japonica Intermediate	241	69.30%	0.40%	0.83%	29.46%	NA
VI/Aromatic	96	7.30%	3.10%	6.25%	83.33%	NA
Intermediate	90	43.30%	7.80%	0.00%	48.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0911386408	T -> DEL	N	N	silent_mutation	Average:10.058; most accessible tissue: Callus, score: 48.523	N	N	N	N
vg0911386408	T -> C	LOC_Os09g18594.1	upstream_gene_variant ; 737.0bp to feature; MODIFIER	silent_mutation	Average:10.058; most accessible tissue: Callus, score: 48.523	N	N	N	N
vg0911386408	T -> C	LOC_Os09g18594.2	upstream_gene_variant ; 4572.0bp to feature; MODIFIER	silent_mutation	Average:10.058; most accessible tissue: Callus, score: 48.523	N	N	N	N
vg0911386408	T -> C	LOC_Os09g18580.1	downstream_gene_variant ; 2598.0bp to feature; MODIFIER	silent_mutation	Average:10.058; most accessible tissue: Callus, score: 48.523	N	N	N	N
vg0911386408	T -> C	LOC_Os09g18580-LOC_Os09g18594	intergenic_region ; MODIFIER	silent_mutation	Average:10.058; most accessible tissue: Callus, score: 48.523	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0911386408	1.47E-06	NA	mr1371	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911386408	2.02E-06	6.30E-06	mr1371	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251