\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0911386408:

Variant ID: vg0911386408 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 11386408
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.58, T: 0.42, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:


TCATAAAAGTTTGACTAGAACGGCAAACCCGAGTAGAAGATTGAAACCGTCGAACTCATTGAGATCGATCTCGGCACATCTCTAGAAATTGATTCCATCG[T/C]
ACTTCTCGATGGAAAGCTCGACGCACCCCTACCTGGCGCGCCAACTGTCGAAACAATATTTCAGCAATATAGAGGGGTAGCGCACGAGACCTAAAAGTAG

Reverse complement sequence

CTACTTTTAGGTCTCGTGCGCTACCCCTCTATATTGCTGAAATATTGTTTCGACAGTTGGCGCGCCAGGTAGGGGTGCGTCGAGCTTTCCATCGAGAAGT[A/G]
CGATGGAATCAATTTCTAGAGATGTGCCGAGATCGATCTCAATGAGTTCGACGGTTTCAATCTTCTACTCGGGTTTGCCGTTCTAGTCAAACTTTTATGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.40% 8.10% 0.68% 64.75% NA
All Indica  2759 3.30% 12.40% 0.76% 83.54% NA
All Japonica  1512 72.20% 1.70% 0.20% 25.86% NA
Aus  269 7.10% 3.00% 0.74% 89.22% NA
Indica I  595 5.50% 10.40% 0.50% 83.53% NA
Indica II  465 4.50% 4.50% 1.29% 89.68% NA
Indica III  913 0.90% 18.40% 0.33% 80.39% NA
Indica Intermediate  786 3.80% 11.50% 1.15% 83.59% NA
Temperate Japonica  767 67.50% 0.30% 0.13% 32.07% NA
Tropical Japonica  504 80.80% 4.60% 0.00% 14.68% NA
Japonica Intermediate  241 69.30% 0.40% 0.83% 29.46% NA
VI/Aromatic  96 7.30% 3.10% 6.25% 83.33% NA
Intermediate  90 43.30% 7.80% 0.00% 48.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0911386408 T -> DEL N N silent_mutation Average:10.058; most accessible tissue: Callus, score: 48.523 N N N N
vg0911386408 T -> C LOC_Os09g18594.1 upstream_gene_variant ; 737.0bp to feature; MODIFIER silent_mutation Average:10.058; most accessible tissue: Callus, score: 48.523 N N N N
vg0911386408 T -> C LOC_Os09g18594.2 upstream_gene_variant ; 4572.0bp to feature; MODIFIER silent_mutation Average:10.058; most accessible tissue: Callus, score: 48.523 N N N N
vg0911386408 T -> C LOC_Os09g18580.1 downstream_gene_variant ; 2598.0bp to feature; MODIFIER silent_mutation Average:10.058; most accessible tissue: Callus, score: 48.523 N N N N
vg0911386408 T -> C LOC_Os09g18580-LOC_Os09g18594 intergenic_region ; MODIFIER silent_mutation Average:10.058; most accessible tissue: Callus, score: 48.523 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0911386408 1.47E-06 NA mr1371 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911386408 2.02E-06 6.30E-06 mr1371 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251