\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0911368113:

Variant ID: vg0911368113 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 11368113
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 34. )

Flanking Sequence (100 bp) in Reference Genome:


GATTCATGTTTAGGGGCAGCCACGTTGTGGGTATAAATAGATGAGAGGTTGAGAGTAAAAGATATCGACTTTTTGGAAGAGAAAACATAGTGTCTGCTTC[A/G]
AGGTTTCAATTCTAGTTCGAGAGTTGAGAGAGGAGTGCTTTAGATGCACTTTCTAAACACATATTGATGCAATAAAGTTGATCTACCACTACTACTGGAT

Reverse complement sequence

ATCCAGTAGTAGTGGTAGATCAACTTTATTGCATCAATATGTGTTTAGAAAGTGCATCTAAAGCACTCCTCTCTCAACTCTCGAACTAGAATTGAAACCT[T/C]
GAAGCAGACACTATGTTTTCTCTTCCAAAAAGTCGATATCTTTTACTCTCAACCTCTCATCTATTTATACCCACAACGTGGCTGCCCCTAAACATGAATC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.70% 8.40% 12.21% 32.67% NA
All Indica  2759 35.10% 13.60% 16.89% 34.43% NA
All Japonica  1512 72.50% 0.40% 3.97% 23.15% NA
Aus  269 19.30% 0.70% 5.95% 73.98% NA
Indica I  595 33.40% 0.50% 32.77% 33.28% NA
Indica II  465 19.60% 34.60% 13.33% 32.47% NA
Indica III  913 45.10% 11.30% 11.17% 32.42% NA
Indica Intermediate  786 33.80% 13.70% 13.61% 38.80% NA
Temperate Japonica  767 67.10% 0.70% 4.43% 27.77% NA
Tropical Japonica  504 81.30% 0.00% 0.79% 17.86% NA
Japonica Intermediate  241 71.00% 0.40% 9.13% 19.50% NA
VI/Aromatic  96 40.60% 1.00% 28.12% 30.21% NA
Intermediate  90 56.70% 16.70% 8.89% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0911368113 A -> G LOC_Os09g18530.1 upstream_gene_variant ; 4933.0bp to feature; MODIFIER silent_mutation Average:16.215; most accessible tissue: Callus, score: 33.155 N N N N
vg0911368113 A -> G LOC_Os09g18540.1 upstream_gene_variant ; 992.0bp to feature; MODIFIER silent_mutation Average:16.215; most accessible tissue: Callus, score: 33.155 N N N N
vg0911368113 A -> G LOC_Os09g18540-LOC_Os09g18560 intergenic_region ; MODIFIER silent_mutation Average:16.215; most accessible tissue: Callus, score: 33.155 N N N N
vg0911368113 A -> DEL N N silent_mutation Average:16.215; most accessible tissue: Callus, score: 33.155 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0911368113 NA 1.01E-09 mr1903 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911368113 NA 4.43E-10 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911368113 NA 1.75E-06 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911368113 NA 8.38E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911368113 NA 1.28E-07 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911368113 NA 6.87E-06 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911368113 4.39E-06 NA mr1619_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911368113 NA 1.44E-06 mr1717_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911368113 NA 9.69E-09 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911368113 NA 6.34E-09 mr1907_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911368113 NA 4.51E-06 mr1928_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911368113 NA 7.41E-10 mr1934_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251