Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0911368113:

Variant ID: vg0911368113 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 11368113
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 34. )

Flanking Sequence (100 bp) in Reference Genome:

GATTCATGTTTAGGGGCAGCCACGTTGTGGGTATAAATAGATGAGAGGTTGAGAGTAAAAGATATCGACTTTTTGGAAGAGAAAACATAGTGTCTGCTTC[A/G]
AGGTTTCAATTCTAGTTCGAGAGTTGAGAGAGGAGTGCTTTAGATGCACTTTCTAAACACATATTGATGCAATAAAGTTGATCTACCACTACTACTGGAT

Reverse complement sequence

ATCCAGTAGTAGTGGTAGATCAACTTTATTGCATCAATATGTGTTTAGAAAGTGCATCTAAAGCACTCCTCTCTCAACTCTCGAACTAGAATTGAAACCT[T/C]
GAAGCAGACACTATGTTTTCTCTTCCAAAAAGTCGATATCTTTTACTCTCAACCTCTCATCTATTTATACCCACAACGTGGCTGCCCCTAAACATGAATC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.70%	8.40%	12.21%	32.67%	NA
All Indica	2759	35.10%	13.60%	16.89%	34.43%	NA
All Japonica	1512	72.50%	0.40%	3.97%	23.15%	NA
Aus	269	19.30%	0.70%	5.95%	73.98%	NA
Indica I	595	33.40%	0.50%	32.77%	33.28%	NA
Indica II	465	19.60%	34.60%	13.33%	32.47%	NA
Indica III	913	45.10%	11.30%	11.17%	32.42%	NA
Indica Intermediate	786	33.80%	13.70%	13.61%	38.80%	NA
Temperate Japonica	767	67.10%	0.70%	4.43%	27.77%	NA
Tropical Japonica	504	81.30%	0.00%	0.79%	17.86%	NA
Japonica Intermediate	241	71.00%	0.40%	9.13%	19.50%	NA
VI/Aromatic	96	40.60%	1.00%	28.12%	30.21%	NA
Intermediate	90	56.70%	16.70%	8.89%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0911368113	A -> G	LOC_Os09g18530.1	upstream_gene_variant ; 4933.0bp to feature; MODIFIER	silent_mutation	Average:16.215; most accessible tissue: Callus, score: 33.155	N	N	N	N
vg0911368113	A -> G	LOC_Os09g18540.1	upstream_gene_variant ; 992.0bp to feature; MODIFIER	silent_mutation	Average:16.215; most accessible tissue: Callus, score: 33.155	N	N	N	N
vg0911368113	A -> G	LOC_Os09g18540-LOC_Os09g18560	intergenic_region ; MODIFIER	silent_mutation	Average:16.215; most accessible tissue: Callus, score: 33.155	N	N	N	N
vg0911368113	A -> DEL	N	N	silent_mutation	Average:16.215; most accessible tissue: Callus, score: 33.155	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0911368113	NA	1.01E-09	mr1903	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911368113	NA	4.43E-10	mr1934	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911368113	NA	1.75E-06	mr1974	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911368113	NA	8.38E-06	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911368113	NA	1.28E-07	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911368113	NA	6.87E-06	mr1354_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911368113	4.39E-06	NA	mr1619_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911368113	NA	1.44E-06	mr1717_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911368113	NA	9.69E-09	mr1896_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911368113	NA	6.34E-09	mr1907_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911368113	NA	4.51E-06	mr1928_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911368113	NA	7.41E-10	mr1934_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251