\
| Variant ID: vg0911368113 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 11368113 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 34. )
GATTCATGTTTAGGGGCAGCCACGTTGTGGGTATAAATAGATGAGAGGTTGAGAGTAAAAGATATCGACTTTTTGGAAGAGAAAACATAGTGTCTGCTTC[A/G]
AGGTTTCAATTCTAGTTCGAGAGTTGAGAGAGGAGTGCTTTAGATGCACTTTCTAAACACATATTGATGCAATAAAGTTGATCTACCACTACTACTGGAT
ATCCAGTAGTAGTGGTAGATCAACTTTATTGCATCAATATGTGTTTAGAAAGTGCATCTAAAGCACTCCTCTCTCAACTCTCGAACTAGAATTGAAACCT[T/C]
GAAGCAGACACTATGTTTTCTCTTCCAAAAAGTCGATATCTTTTACTCTCAACCTCTCATCTATTTATACCCACAACGTGGCTGCCCCTAAACATGAATC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.70% | 8.40% | 12.21% | 32.67% | NA |
| All Indica | 2759 | 35.10% | 13.60% | 16.89% | 34.43% | NA |
| All Japonica | 1512 | 72.50% | 0.40% | 3.97% | 23.15% | NA |
| Aus | 269 | 19.30% | 0.70% | 5.95% | 73.98% | NA |
| Indica I | 595 | 33.40% | 0.50% | 32.77% | 33.28% | NA |
| Indica II | 465 | 19.60% | 34.60% | 13.33% | 32.47% | NA |
| Indica III | 913 | 45.10% | 11.30% | 11.17% | 32.42% | NA |
| Indica Intermediate | 786 | 33.80% | 13.70% | 13.61% | 38.80% | NA |
| Temperate Japonica | 767 | 67.10% | 0.70% | 4.43% | 27.77% | NA |
| Tropical Japonica | 504 | 81.30% | 0.00% | 0.79% | 17.86% | NA |
| Japonica Intermediate | 241 | 71.00% | 0.40% | 9.13% | 19.50% | NA |
| VI/Aromatic | 96 | 40.60% | 1.00% | 28.12% | 30.21% | NA |
| Intermediate | 90 | 56.70% | 16.70% | 8.89% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0911368113 | A -> G | LOC_Os09g18530.1 | upstream_gene_variant ; 4933.0bp to feature; MODIFIER | silent_mutation | Average:16.215; most accessible tissue: Callus, score: 33.155 | N | N | N | N |
| vg0911368113 | A -> G | LOC_Os09g18540.1 | upstream_gene_variant ; 992.0bp to feature; MODIFIER | silent_mutation | Average:16.215; most accessible tissue: Callus, score: 33.155 | N | N | N | N |
| vg0911368113 | A -> G | LOC_Os09g18540-LOC_Os09g18560 | intergenic_region ; MODIFIER | silent_mutation | Average:16.215; most accessible tissue: Callus, score: 33.155 | N | N | N | N |
| vg0911368113 | A -> DEL | N | N | silent_mutation | Average:16.215; most accessible tissue: Callus, score: 33.155 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0911368113 | NA | 1.01E-09 | mr1903 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911368113 | NA | 4.43E-10 | mr1934 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911368113 | NA | 1.75E-06 | mr1974 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911368113 | NA | 8.38E-06 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911368113 | NA | 1.28E-07 | mr1310_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911368113 | NA | 6.87E-06 | mr1354_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911368113 | 4.39E-06 | NA | mr1619_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911368113 | NA | 1.44E-06 | mr1717_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911368113 | NA | 9.69E-09 | mr1896_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911368113 | NA | 6.34E-09 | mr1907_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911368113 | NA | 4.51E-06 | mr1928_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911368113 | NA | 7.41E-10 | mr1934_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |