\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0911246065:

Variant ID: vg0911246065 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 11246065
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCGGCAATGATGACGACGAGCTACGGCGACGATTTTTTTCGCGATTTATATATATATATATATATTTGAAATTTTGTTTTCTTGTGCGGTCGGTATAACT[G/A]
GACAGCACGGGATAATCGATTATGCCGTGCGGTCCACTTAACCCGACCGCACGGAAAGATGTATTTTTCTGTGCGGTTGGGCCGCCCACACACGAAAGTA

Reverse complement sequence

TACTTTCGTGTGTGGGCGGCCCAACCGCACAGAAAAATACATCTTTCCGTGCGGTCGGGTTAAGTGGACCGCACGGCATAATCGATTATCCCGTGCTGTC[C/T]
AGTTATACCGACCGCACAAGAAAACAAAATTTCAAATATATATATATATATATAAATCGCGAAAAAAATCGTCGCCGTAGCTCGTCGTCATCATTGCCGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.80% 10.20% 0.04% 0.00% NA
All Indica  2759 96.90% 3.10% 0.00% 0.00% NA
All Japonica  1512 92.50% 7.40% 0.07% 0.00% NA
Aus  269 29.40% 70.60% 0.00% 0.00% NA
Indica I  595 97.30% 2.70% 0.00% 0.00% NA
Indica II  465 93.50% 6.50% 0.00% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 96.10% 3.90% 0.00% 0.00% NA
Temperate Japonica  767 93.60% 6.30% 0.13% 0.00% NA
Tropical Japonica  504 97.80% 2.20% 0.00% 0.00% NA
Japonica Intermediate  241 78.00% 22.00% 0.00% 0.00% NA
VI/Aromatic  96 18.80% 80.20% 1.04% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0911246065 G -> A LOC_Os09g18330.1 upstream_gene_variant ; 1675.0bp to feature; MODIFIER silent_mutation Average:56.224; most accessible tissue: Zhenshan97 flag leaf, score: 70.837 N N N N
vg0911246065 G -> A LOC_Os09g18340.1 upstream_gene_variant ; 4734.0bp to feature; MODIFIER silent_mutation Average:56.224; most accessible tissue: Zhenshan97 flag leaf, score: 70.837 N N N N
vg0911246065 G -> A LOC_Os09g18320-LOC_Os09g18330 intergenic_region ; MODIFIER silent_mutation Average:56.224; most accessible tissue: Zhenshan97 flag leaf, score: 70.837 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0911246065 7.04E-08 1.23E-24 mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911246065 NA 3.24E-24 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911246065 NA 6.60E-13 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911246065 2.78E-06 4.86E-15 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911246065 7.94E-10 3.80E-30 mr1586 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911246065 NA 8.07E-16 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911246065 NA 7.74E-12 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911246065 NA 3.52E-11 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251