\
| Variant ID: vg0911246065 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 11246065 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCGGCAATGATGACGACGAGCTACGGCGACGATTTTTTTCGCGATTTATATATATATATATATATTTGAAATTTTGTTTTCTTGTGCGGTCGGTATAACT[G/A]
GACAGCACGGGATAATCGATTATGCCGTGCGGTCCACTTAACCCGACCGCACGGAAAGATGTATTTTTCTGTGCGGTTGGGCCGCCCACACACGAAAGTA
TACTTTCGTGTGTGGGCGGCCCAACCGCACAGAAAAATACATCTTTCCGTGCGGTCGGGTTAAGTGGACCGCACGGCATAATCGATTATCCCGTGCTGTC[C/T]
AGTTATACCGACCGCACAAGAAAACAAAATTTCAAATATATATATATATATATAAATCGCGAAAAAAATCGTCGCCGTAGCTCGTCGTCATCATTGCCGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.80% | 10.20% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 92.50% | 7.40% | 0.07% | 0.00% | NA |
| Aus | 269 | 29.40% | 70.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 93.50% | 6.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 93.60% | 6.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.00% | 22.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 18.80% | 80.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0911246065 | G -> A | LOC_Os09g18330.1 | upstream_gene_variant ; 1675.0bp to feature; MODIFIER | silent_mutation | Average:56.224; most accessible tissue: Zhenshan97 flag leaf, score: 70.837 | N | N | N | N |
| vg0911246065 | G -> A | LOC_Os09g18340.1 | upstream_gene_variant ; 4734.0bp to feature; MODIFIER | silent_mutation | Average:56.224; most accessible tissue: Zhenshan97 flag leaf, score: 70.837 | N | N | N | N |
| vg0911246065 | G -> A | LOC_Os09g18320-LOC_Os09g18330 | intergenic_region ; MODIFIER | silent_mutation | Average:56.224; most accessible tissue: Zhenshan97 flag leaf, score: 70.837 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0911246065 | 7.04E-08 | 1.23E-24 | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911246065 | NA | 3.24E-24 | mr1305 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911246065 | NA | 6.60E-13 | mr1409 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911246065 | 2.78E-06 | 4.86E-15 | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911246065 | 7.94E-10 | 3.80E-30 | mr1586 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911246065 | NA | 8.07E-16 | mr1765 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911246065 | NA | 7.74E-12 | mr1409_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911246065 | NA | 3.52E-11 | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |