\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0911164560:

Variant ID: vg0911164560 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 11164560
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TTAAATTGGGACTTATGTCAAATTGAGACTTATGTGAAATTGCGTTAAATTGGGACTTACGTAAAATTGGGACTTATGTCAAATTTTTTTACGTCAAGTT[A/G]
GAAGATGTCGAACTAAAAGGTTCCATCGAACGCACCAATAGCGCCTCAAGAAGGTAACGCTCCTCAAAATTTCGGTAGCAATAAGCAGCCAGACGCTTCT

Reverse complement sequence

AGAAGCGTCTGGCTGCTTATTGCTACCGAAATTTTGAGGAGCGTTACCTTCTTGAGGCGCTATTGGTGCGTTCGATGGAACCTTTTAGTTCGACATCTTC[T/C]
AACTTGACGTAAAAAAATTTGACATAAGTCCCAATTTTACGTAAGTCCCAATTTAACGCAATTTCACATAAGTCTCAATTTGACATAAGTCCCAATTTAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.60% 0.40% 19.47% 57.49% NA
All Indica  2759 3.80% 0.40% 9.13% 86.63% NA
All Japonica  1512 60.30% 0.20% 28.17% 11.31% NA
Aus  269 1.90% 1.50% 76.21% 20.45% NA
Indica I  595 4.20% 0.20% 10.42% 85.21% NA
Indica II  465 6.70% 0.20% 9.46% 83.66% NA
Indica III  913 0.80% 0.70% 9.75% 88.83% NA
Indica Intermediate  786 5.50% 0.40% 7.25% 86.90% NA
Temperate Japonica  767 64.40% 0.10% 26.47% 9.00% NA
Tropical Japonica  504 55.20% 0.40% 37.10% 7.34% NA
Japonica Intermediate  241 58.10% 0.00% 14.94% 26.97% NA
VI/Aromatic  96 14.60% 1.00% 15.62% 68.75% NA
Intermediate  90 36.70% 0.00% 24.44% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0911164560 A -> G LOC_Os09g18220.1 upstream_gene_variant ; 492.0bp to feature; MODIFIER silent_mutation Average:11.646; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0911164560 A -> G LOC_Os09g18210.1 downstream_gene_variant ; 1666.0bp to feature; MODIFIER silent_mutation Average:11.646; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0911164560 A -> G LOC_Os09g18210-LOC_Os09g18220 intergenic_region ; MODIFIER silent_mutation Average:11.646; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0911164560 A -> DEL N N silent_mutation Average:11.646; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0911164560 8.99E-06 NA mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911164560 4.28E-06 1.93E-06 mr1768 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251