\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0911066866:

Variant ID: vg0911066866 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 11066866
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTATAAAACTCATTAAATACAAATCTATAAGTTTACATGTAAATATTCCCTCCGTTTCTAAATGTTTGACACTTTTTAAGCACATGTTTGATCATTCGT[T/C]
TTATTAAAAAAATTTATGAAATATGTAAAATTATATATATACATGAAAGCATATTTAACAATAAATCAAATGATAGGAAAATAATTAATAATTACTTAAA

Reverse complement sequence

TTTAAGTAATTATTAATTATTTTCCTATCATTTGATTTATTGTTAAATATGCTTTCATGTATATATATAATTTTACATATTTCATAAATTTTTTTAATAA[A/G]
ACGAATGATCAAACATGTGCTTAAAAAGTGTCAAACATTTAGAAACGGAGGGAATATTTACATGTAAACTTATAGATTTGTATTTAATGAGTTTTATAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.90% 11.80% 0.51% 57.79% NA
All Indica  2759 3.60% 3.60% 0.58% 92.17% NA
All Japonica  1512 83.70% 13.20% 0.00% 3.04% NA
Aus  269 0.70% 77.70% 2.23% 19.33% NA
Indica I  595 10.10% 3.20% 0.34% 86.39% NA
Indica II  465 2.60% 6.90% 0.00% 90.54% NA
Indica III  913 0.70% 1.20% 0.99% 97.15% NA
Indica Intermediate  786 2.80% 4.80% 0.64% 91.73% NA
Temperate Japonica  767 85.70% 13.00% 0.00% 1.30% NA
Tropical Japonica  504 88.70% 5.40% 0.00% 5.95% NA
Japonica Intermediate  241 67.20% 30.30% 0.00% 2.49% NA
VI/Aromatic  96 6.20% 41.70% 0.00% 52.08% NA
Intermediate  90 45.60% 7.80% 2.22% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0911066866 T -> DEL N N silent_mutation Average:16.026; most accessible tissue: Callus, score: 26.434 N N N N
vg0911066866 T -> C LOC_Os09g18050.1 upstream_gene_variant ; 1581.0bp to feature; MODIFIER silent_mutation Average:16.026; most accessible tissue: Callus, score: 26.434 N N N N
vg0911066866 T -> C LOC_Os09g18060.1 downstream_gene_variant ; 4296.0bp to feature; MODIFIER silent_mutation Average:16.026; most accessible tissue: Callus, score: 26.434 N N N N
vg0911066866 T -> C LOC_Os09g18040-LOC_Os09g18050 intergenic_region ; MODIFIER silent_mutation Average:16.026; most accessible tissue: Callus, score: 26.434 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0911066866 4.28E-06 1.15E-06 mr1210 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911066866 6.11E-06 6.11E-06 mr1240 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911066866 6.90E-06 1.66E-07 mr1305 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911066866 NA 4.66E-14 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911066866 2.30E-07 2.54E-07 mr1409 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911066866 NA 8.17E-06 mr1585 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911066866 4.43E-06 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911066866 2.50E-06 6.20E-09 mr1586 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911066866 2.14E-06 2.14E-06 mr1738 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911066866 NA 8.41E-06 mr1305_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911066866 NA 1.38E-12 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911066866 NA 5.01E-15 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251