\
| Variant ID: vg0911066866 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 11066866 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ACTATAAAACTCATTAAATACAAATCTATAAGTTTACATGTAAATATTCCCTCCGTTTCTAAATGTTTGACACTTTTTAAGCACATGTTTGATCATTCGT[T/C]
TTATTAAAAAAATTTATGAAATATGTAAAATTATATATATACATGAAAGCATATTTAACAATAAATCAAATGATAGGAAAATAATTAATAATTACTTAAA
TTTAAGTAATTATTAATTATTTTCCTATCATTTGATTTATTGTTAAATATGCTTTCATGTATATATATAATTTTACATATTTCATAAATTTTTTTAATAA[A/G]
ACGAATGATCAAACATGTGCTTAAAAAGTGTCAAACATTTAGAAACGGAGGGAATATTTACATGTAAACTTATAGATTTGTATTTAATGAGTTTTATAGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.90% | 11.80% | 0.51% | 57.79% | NA |
| All Indica | 2759 | 3.60% | 3.60% | 0.58% | 92.17% | NA |
| All Japonica | 1512 | 83.70% | 13.20% | 0.00% | 3.04% | NA |
| Aus | 269 | 0.70% | 77.70% | 2.23% | 19.33% | NA |
| Indica I | 595 | 10.10% | 3.20% | 0.34% | 86.39% | NA |
| Indica II | 465 | 2.60% | 6.90% | 0.00% | 90.54% | NA |
| Indica III | 913 | 0.70% | 1.20% | 0.99% | 97.15% | NA |
| Indica Intermediate | 786 | 2.80% | 4.80% | 0.64% | 91.73% | NA |
| Temperate Japonica | 767 | 85.70% | 13.00% | 0.00% | 1.30% | NA |
| Tropical Japonica | 504 | 88.70% | 5.40% | 0.00% | 5.95% | NA |
| Japonica Intermediate | 241 | 67.20% | 30.30% | 0.00% | 2.49% | NA |
| VI/Aromatic | 96 | 6.20% | 41.70% | 0.00% | 52.08% | NA |
| Intermediate | 90 | 45.60% | 7.80% | 2.22% | 44.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0911066866 | T -> DEL | N | N | silent_mutation | Average:16.026; most accessible tissue: Callus, score: 26.434 | N | N | N | N |
| vg0911066866 | T -> C | LOC_Os09g18050.1 | upstream_gene_variant ; 1581.0bp to feature; MODIFIER | silent_mutation | Average:16.026; most accessible tissue: Callus, score: 26.434 | N | N | N | N |
| vg0911066866 | T -> C | LOC_Os09g18060.1 | downstream_gene_variant ; 4296.0bp to feature; MODIFIER | silent_mutation | Average:16.026; most accessible tissue: Callus, score: 26.434 | N | N | N | N |
| vg0911066866 | T -> C | LOC_Os09g18040-LOC_Os09g18050 | intergenic_region ; MODIFIER | silent_mutation | Average:16.026; most accessible tissue: Callus, score: 26.434 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0911066866 | 4.28E-06 | 1.15E-06 | mr1210 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911066866 | 6.11E-06 | 6.11E-06 | mr1240 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911066866 | 6.90E-06 | 1.66E-07 | mr1305 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911066866 | NA | 4.66E-14 | mr1409 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911066866 | 2.30E-07 | 2.54E-07 | mr1409 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911066866 | NA | 8.17E-06 | mr1585 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911066866 | 4.43E-06 | NA | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911066866 | 2.50E-06 | 6.20E-09 | mr1586 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911066866 | 2.14E-06 | 2.14E-06 | mr1738 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911066866 | NA | 8.41E-06 | mr1305_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911066866 | NA | 1.38E-12 | mr1409_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911066866 | NA | 5.01E-15 | mr1807_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |