\
| Variant ID: vg0911061673 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 11061673 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GACGTCAGCCCTGGGAATTATGGCGCAATAAATTATATAAGGGCTTTCTGTTATAGTAATAAACACAGTGAATCTTCTAAAATTCATATGTAATTCATCC[G/A]
AGCTCCGTTTAAGCCCATTCAAGTCGCAGTAAATCAAGAAAAATGTGTAGAATCCATTAAAAATGGTTTTGTTCTCTGTTTCAGTAGTCTTATAGCCTGT
ACAGGCTATAAGACTACTGAAACAGAGAACAAAACCATTTTTAATGGATTCTACACATTTTTCTTGATTTACTGCGACTTGAATGGGCTTAAACGGAGCT[C/T]
GGATGAATTACATATGAATTTTAGAAGATTCACTGTGTTTATTACTATAACAGAAAGCCCTTATATAATTTATTGCGCCATAATTCCCAGGGCTGACGTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.70% | 11.70% | 1.61% | 53.96% | NA |
| All Indica | 2759 | 8.30% | 3.60% | 2.36% | 85.79% | NA |
| All Japonica | 1512 | 83.70% | 13.30% | 0.13% | 2.91% | NA |
| Aus | 269 | 0.70% | 77.70% | 2.60% | 18.96% | NA |
| Indica I | 595 | 10.80% | 3.20% | 0.34% | 85.71% | NA |
| Indica II | 465 | 6.90% | 6.90% | 1.51% | 84.73% | NA |
| Indica III | 913 | 10.00% | 1.20% | 4.38% | 84.45% | NA |
| Indica Intermediate | 786 | 5.20% | 4.70% | 2.04% | 88.04% | NA |
| Temperate Japonica | 767 | 85.50% | 13.20% | 0.00% | 1.30% | NA |
| Tropical Japonica | 504 | 88.70% | 5.40% | 0.20% | 5.75% | NA |
| Japonica Intermediate | 241 | 67.20% | 30.30% | 0.41% | 2.07% | NA |
| VI/Aromatic | 96 | 7.30% | 39.60% | 0.00% | 53.12% | NA |
| Intermediate | 90 | 48.90% | 7.80% | 2.22% | 41.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0911061673 | G -> DEL | N | N | silent_mutation | Average:7.084; most accessible tissue: Callus, score: 13.324 | N | N | N | N |
| vg0911061673 | G -> A | LOC_Os09g18040.1 | upstream_gene_variant ; 866.0bp to feature; MODIFIER | silent_mutation | Average:7.084; most accessible tissue: Callus, score: 13.324 | N | N | N | N |
| vg0911061673 | G -> A | LOC_Os09g18040-LOC_Os09g18050 | intergenic_region ; MODIFIER | silent_mutation | Average:7.084; most accessible tissue: Callus, score: 13.324 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0911061673 | NA | 7.42E-06 | mr1210 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911061673 | NA | 6.56E-07 | mr1305 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911061673 | NA | 4.71E-13 | mr1409 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911061673 | NA | 2.07E-06 | mr1585 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911061673 | 7.60E-06 | 5.02E-24 | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911061673 | NA | 3.63E-08 | mr1586 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911061673 | NA | 2.78E-10 | mr1927 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911061673 | NA | 6.56E-06 | mr1305_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911061673 | NA | 3.60E-13 | mr1409_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0911061673 | NA | 9.65E-17 | mr1807_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |