\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0911021962:

Variant ID: vg0911021962 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 11021962
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.68, A: 0.32, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


GTAGAGGGAAGATATTAGATGTGTGGATGGTAAGGTTAGCATCAGAACCGAGCAAGGCCTGCTCCGTCAATATTGTGACAGAAGGTTGCCTGAGCTAGGT[G/A]
TTGGGAAGGGGACCAACCTCAGTGATCACCTCTGCCATGAAGGTGGTGGTGGTGGATGAGGGAGCGACAATTTGGGAGGAGGTATGTCGGGTGCAGCCGC

Reverse complement sequence

GCGGCTGCACCCGACATACCTCCTCCCAAATTGTCGCTCCCTCATCCACCACCACCACCTTCATGGCAGAGGTGATCACTGAGGTTGGTCCCCTTCCCAA[C/T]
ACCTAGCTCAGGCAACCTTCTGTCACAATATTGACGGAGCAGGCCTTGCTCGGTTCTGATGCTAACCTTACCATCCACACATCTAATATCTTCCCTCTAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.60% 48.00% 0.04% 2.37% NA
All Indica  2759 78.70% 21.10% 0.00% 0.18% NA
All Japonica  1512 8.30% 86.20% 0.07% 5.42% NA
Aus  269 4.50% 95.50% 0.00% 0.00% NA
Indica I  595 76.10% 23.90% 0.00% 0.00% NA
Indica II  465 90.80% 9.00% 0.00% 0.22% NA
Indica III  913 73.20% 26.80% 0.00% 0.00% NA
Indica Intermediate  786 79.90% 19.60% 0.00% 0.51% NA
Temperate Japonica  767 10.30% 86.70% 0.00% 3.00% NA
Tropical Japonica  504 4.40% 93.50% 0.00% 2.18% NA
Japonica Intermediate  241 10.00% 69.70% 0.41% 19.92% NA
VI/Aromatic  96 5.20% 71.90% 1.04% 21.88% NA
Intermediate  90 32.20% 63.30% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0911021962 G -> DEL N N silent_mutation Average:66.584; most accessible tissue: Zhenshan97 young leaf, score: 87.723 N N N N
vg0911021962 G -> A LOC_Os09g18010.1 upstream_gene_variant ; 84.0bp to feature; MODIFIER silent_mutation Average:66.584; most accessible tissue: Zhenshan97 young leaf, score: 87.723 N N N N
vg0911021962 G -> A LOC_Os09g18000.1 downstream_gene_variant ; 624.0bp to feature; MODIFIER silent_mutation Average:66.584; most accessible tissue: Zhenshan97 young leaf, score: 87.723 N N N N
vg0911021962 G -> A LOC_Os09g18000-LOC_Os09g18010 intergenic_region ; MODIFIER silent_mutation Average:66.584; most accessible tissue: Zhenshan97 young leaf, score: 87.723 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0911021962 G A 0.0 0.0 0.0 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0911021962 NA 4.83E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911021962 NA 7.70E-06 mr1734 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911021962 NA 6.99E-10 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911021962 NA 2.50E-06 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911021962 NA 1.34E-12 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911021962 NA 3.10E-16 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911021962 NA 1.84E-06 mr1654_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911021962 NA 3.64E-11 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911021962 NA 8.52E-09 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0911021962 4.78E-06 9.17E-08 mr1834_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251