\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910939326:

Variant ID: vg0910939326 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10939326
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGCTGTGAGGTGAGCCTTGCATGCTGCTGCCCCTTTTACTCTCTTTGTCTCTCTACCTCATTGCGAGGTGGGCCAATGATGTTGGGGCAGGCCTCAGCT[A/G]
CCGTATCTTCATCTCCCCCGAGGCCAGGGGCGGACTTAGGCCTCGGGCCACCTAGGCCGTGGCCCGAGGCCTAGGACTGAAGGCCCATGGAGATAGTCTA

Reverse complement sequence

TAGACTATCTCCATGGGCCTTCAGTCCTAGGCCTCGGGCCACGGCCTAGGTGGCCCGAGGCCTAAGTCCGCCCCTGGCCTCGGGGGAGATGAAGATACGG[T/C]
AGCTGAGGCCTGCCCCAACATCATTGGCCCACCTCGCAATGAGGTAGAGAGACAAAGAGAGTAAAAGGGGCAGCAGCATGCAAGGCTCACCTCACAGCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.40% 31.30% 0.32% 21.01% NA
All Indica  2759 68.30% 3.40% 0.40% 27.87% NA
All Japonica  1512 3.40% 84.50% 0.26% 11.84% NA
Aus  269 95.20% 4.10% 0.00% 0.74% NA
Indica I  595 76.00% 9.40% 0.17% 14.45% NA
Indica II  465 54.00% 2.20% 0.43% 43.44% NA
Indica III  913 72.30% 0.80% 0.55% 26.40% NA
Indica Intermediate  786 66.40% 2.70% 0.38% 30.53% NA
Temperate Japonica  767 0.90% 86.60% 0.52% 11.99% NA
Tropical Japonica  504 6.50% 88.70% 0.00% 4.76% NA
Japonica Intermediate  241 4.60% 69.30% 0.00% 26.14% NA
VI/Aromatic  96 22.90% 53.10% 0.00% 23.96% NA
Intermediate  90 26.70% 51.10% 0.00% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910939326 A -> G LOC_Os09g17880.1 missense_variant ; p.Thr360Ala; MODERATE nonsynonymous_codon ; T360A Average:76.179; most accessible tissue: Zhenshan97 panicle, score: 89.143 unknown unknown TOLERATED 0.77
vg0910939326 A -> DEL LOC_Os09g17880.1 N frameshift_variant Average:76.179; most accessible tissue: Zhenshan97 panicle, score: 89.143 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0910939326 A G 0.0 0.0 0.0 0.02 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910939326 NA 8.24E-06 mr1179 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910939326 NA 1.63E-06 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910939326 NA 3.86E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910939326 NA 6.40E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910939326 4.66E-06 9.12E-06 mr1704 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910939326 NA 6.27E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910939326 NA 2.95E-06 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251