\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910867315:

Variant ID: vg0910867315 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10867315
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTACAGTCACGCCTTAGGCCGTATTTAGTTCCACGTCAAAATTGAAAGTTTGACTAAAATTGAAAGTTTGAAGAAAAAAGTTGAAAGTTTACGTGTGTA[G/A]
AAAAAAATTGTTGGGATGAAAAAATTGAAAGTTTAAAGAAAAAGTTAGGAACTAAACTCGGTCTTATCTAACTAAACACAGGATTAATCCGGTGGTGATT

Reverse complement sequence

AATCACCACCGGATTAATCCTGTGTTTAGTTAGATAAGACCGAGTTTAGTTCCTAACTTTTTCTTTAAACTTTCAATTTTTTCATCCCAACAATTTTTTT[C/T]
TACACACGTAAACTTTCAACTTTTTTCTTCAAACTTTCAATTTTAGTCAAACTTTCAATTTTGACGTGGAACTAAATACGGCCTAAGGCGTGACTGTAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.90% 13.00% 0.11% 0.00% NA
All Indica  2759 94.00% 5.90% 0.11% 0.00% NA
All Japonica  1512 74.20% 25.70% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 94.50% 5.40% 0.17% 0.00% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 89.90% 10.00% 0.11% 0.00% NA
Indica Intermediate  786 97.20% 2.70% 0.13% 0.00% NA
Temperate Japonica  767 87.10% 12.80% 0.13% 0.00% NA
Tropical Japonica  504 60.50% 39.50% 0.00% 0.00% NA
Japonica Intermediate  241 61.80% 38.20% 0.00% 0.00% NA
VI/Aromatic  96 58.30% 41.70% 0.00% 0.00% NA
Intermediate  90 75.60% 23.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910867315 G -> A LOC_Os09g17760.1 upstream_gene_variant ; 4554.0bp to feature; MODIFIER silent_mutation Average:69.738; most accessible tissue: Minghui63 root, score: 81.852 N N N N
vg0910867315 G -> A LOC_Os09g17760-LOC_Os09g17770 intergenic_region ; MODIFIER silent_mutation Average:69.738; most accessible tissue: Minghui63 root, score: 81.852 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910867315 NA 6.95E-08 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910867315 NA 9.25E-09 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910867315 NA 1.19E-08 mr1503 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910867315 NA 6.30E-07 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910867315 NA 4.02E-09 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910867315 NA 1.37E-08 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910867315 NA 6.47E-06 mr1438_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910867315 NA 1.14E-06 mr1531_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910867315 NA 4.07E-10 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910867315 NA 3.08E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251