RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0910867315:

Variant ID: vg0910867315 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 10867315
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTACAGTCACGCCTTAGGCCGTATTTAGTTCCACGTCAAAATTGAAAGTTTGACTAAAATTGAAAGTTTGAAGAAAAAAGTTGAAAGTTTACGTGTGTA[G/A]
AAAAAAATTGTTGGGATGAAAAAATTGAAAGTTTAAAGAAAAAGTTAGGAACTAAACTCGGTCTTATCTAACTAAACACAGGATTAATCCGGTGGTGATT

Reverse complement sequence

AATCACCACCGGATTAATCCTGTGTTTAGTTAGATAAGACCGAGTTTAGTTCCTAACTTTTTCTTTAAACTTTCAATTTTTTCATCCCAACAATTTTTTT[C/T]
TACACACGTAAACTTTCAACTTTTTTCTTCAAACTTTCAATTTTAGTCAAACTTTCAATTTTGACGTGGAACTAAATACGGCCTAAGGCGTGACTGTAAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.90%	13.00%	0.11%	0.00%	NA
All Indica	2759	94.00%	5.90%	0.11%	0.00%	NA
All Japonica	1512	74.20%	25.70%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	94.50%	5.40%	0.17%	0.00%	NA
Indica II	465	96.10%	3.90%	0.00%	0.00%	NA
Indica III	913	89.90%	10.00%	0.11%	0.00%	NA
Indica Intermediate	786	97.20%	2.70%	0.13%	0.00%	NA
Temperate Japonica	767	87.10%	12.80%	0.13%	0.00%	NA
Tropical Japonica	504	60.50%	39.50%	0.00%	0.00%	NA
Japonica Intermediate	241	61.80%	38.20%	0.00%	0.00%	NA
VI/Aromatic	96	58.30%	41.70%	0.00%	0.00%	NA
Intermediate	90	75.60%	23.30%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0910867315	G -> A	LOC_Os09g17760.1	upstream_gene_variant ; 4554.0bp to feature; MODIFIER	silent_mutation	Average:69.738; most accessible tissue: Minghui63 root, score: 81.852	N	N	N	N
vg0910867315	G -> A	LOC_Os09g17760-LOC_Os09g17770	intergenic_region ; MODIFIER	silent_mutation	Average:69.738; most accessible tissue: Minghui63 root, score: 81.852	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0910867315	NA	6.95E-08	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910867315	NA	9.25E-09	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910867315	NA	1.19E-08	mr1503	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910867315	NA	6.30E-07	mr1794	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910867315	NA	4.02E-09	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910867315	NA	1.37E-08	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910867315	NA	6.47E-06	mr1438_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910867315	NA	1.14E-06	mr1531_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910867315	NA	4.07E-10	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910867315	NA	3.08E-06	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 10 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0910867315:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact