\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910846993:

Variant ID: vg0910846993 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10846993
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.91, G: 0.09, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


AAATACTCCCTCGATCCCAAAATATAACCATTTCTGGCTATGTATAGTGTAAATATGTAGTCTAAATTGTTTATATTGTGGCATGGAAGGATTAATTAGT[G/A]
CTTTAAATTTACGTATACAATAGATTGGGTCGAATCTACGAAGATAATGGATCCTCTGATTTAGTGGGTTAAAATCCAAAGCGTTTGGTCTTAAAAAAAA

Reverse complement sequence

TTTTTTTTAAGACCAAACGCTTTGGATTTTAACCCACTAAATCAGAGGATCCATTATCTTCGTAGATTCGACCCAATCTATTGTATACGTAAATTTAAAG[C/T]
ACTAATTAATCCTTCCATGCCACAATATAAACAATTTAGACTACATATTTACACTATACATAGCCAGAAATGGTTATATTTTGGGATCGAGGGAGTATTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.50% 30.30% 0.04% 0.15% NA
All Indica  2759 71.40% 28.30% 0.07% 0.25% NA
All Japonica  1512 75.60% 24.40% 0.00% 0.00% NA
Aus  269 5.60% 94.40% 0.00% 0.00% NA
Indica I  595 81.70% 18.00% 0.00% 0.34% NA
Indica II  465 78.10% 21.90% 0.00% 0.00% NA
Indica III  913 56.80% 42.80% 0.00% 0.33% NA
Indica Intermediate  786 76.50% 23.00% 0.25% 0.25% NA
Temperate Japonica  767 55.70% 44.30% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 88.80% 11.20% 0.00% 0.00% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910846993 G -> DEL N N silent_mutation Average:80.824; most accessible tissue: Zhenshan97 young leaf, score: 95.617 N N N N
vg0910846993 G -> A LOC_Os09g17740.1 3_prime_UTR_variant ; 360.0bp to feature; MODIFIER silent_mutation Average:80.824; most accessible tissue: Zhenshan97 young leaf, score: 95.617 N N N N
vg0910846993 G -> A LOC_Os09g17730.1 downstream_gene_variant ; 3049.0bp to feature; MODIFIER silent_mutation Average:80.824; most accessible tissue: Zhenshan97 young leaf, score: 95.617 N N N N
vg0910846993 G -> A LOC_Os09g17750.1 downstream_gene_variant ; 2743.0bp to feature; MODIFIER silent_mutation Average:80.824; most accessible tissue: Zhenshan97 young leaf, score: 95.617 N N N N
vg0910846993 G -> A LOC_Os09g17730.2 downstream_gene_variant ; 2992.0bp to feature; MODIFIER silent_mutation Average:80.824; most accessible tissue: Zhenshan97 young leaf, score: 95.617 N N N N
vg0910846993 G -> A LOC_Os09g17750.2 downstream_gene_variant ; 2743.0bp to feature; MODIFIER silent_mutation Average:80.824; most accessible tissue: Zhenshan97 young leaf, score: 95.617 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0910846993 G A -0.01 -0.01 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910846993 NA 3.32E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910846993 NA 6.65E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910846993 NA 1.84E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910846993 NA 3.22E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910846993 NA 8.77E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910846993 NA 8.73E-07 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910846993 NA 9.02E-06 mr1205 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910846993 4.88E-06 4.88E-06 mr1366 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910846993 NA 1.26E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910846993 NA 7.19E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910846993 NA 9.02E-09 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910846993 NA 6.93E-08 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910846993 NA 9.57E-06 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910846993 NA 1.11E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910846993 NA 2.31E-10 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910846993 NA 3.15E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910846993 NA 9.92E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251