\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910844273:

Variant ID: vg0910844273 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10844273
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTAATTGCACAGTTAATTAGTCCATGAAGAAGGAAATCGCGAGACGAATTTTTTGAGTCTAATTAGTCTATGACTAGCCATAAATGCTACAGTAACTCA[C/T]
ATGTGCTAGTCTTGCGGTTTCCAGGTGAGTTATATTTTTTCATTCGTGTCCAAAAAACCCTTCCGACATCCGGTCAAACATCCGATATGACACATAAAAA

Reverse complement sequence

TTTTTATGTGTCATATCGGATGTTTGACCGGATGTCGGAAGGGTTTTTTGGACACGAATGAAAAAATATAACTCACCTGGAAACCGCAAGACTAGCACAT[G/A]
TGAGTTACTGTAGCATTTATGGCTAGTCATAGACTAATTAGACTCAAAAAATTCGTCTCGCGATTTCCTTCTTCATGGACTAATTAACTGTGCAATTAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.70% 11.60% 2.79% 2.88% NA
All Indica  2759 89.30% 1.50% 4.53% 4.68% NA
All Japonica  1512 69.60% 30.40% 0.07% 0.00% NA
Aus  269 96.30% 1.10% 0.74% 1.86% NA
Indica I  595 84.90% 5.40% 7.56% 2.18% NA
Indica II  465 87.50% 0.60% 5.16% 6.67% NA
Indica III  913 92.40% 0.00% 1.97% 5.59% NA
Indica Intermediate  786 89.90% 0.90% 4.83% 4.33% NA
Temperate Japonica  767 82.80% 17.10% 0.13% 0.00% NA
Tropical Japonica  504 61.30% 38.70% 0.00% 0.00% NA
Japonica Intermediate  241 44.80% 55.20% 0.00% 0.00% NA
VI/Aromatic  96 67.70% 31.20% 0.00% 1.04% NA
Intermediate  90 78.90% 15.60% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910844273 C -> DEL N N silent_mutation Average:79.116; most accessible tissue: Minghui63 flag leaf, score: 89.016 N N N N
vg0910844273 C -> T LOC_Os09g17740.1 upstream_gene_variant ; 1405.0bp to feature; MODIFIER silent_mutation Average:79.116; most accessible tissue: Minghui63 flag leaf, score: 89.016 N N N N
vg0910844273 C -> T LOC_Os09g17730.1 downstream_gene_variant ; 329.0bp to feature; MODIFIER silent_mutation Average:79.116; most accessible tissue: Minghui63 flag leaf, score: 89.016 N N N N
vg0910844273 C -> T LOC_Os09g17730.2 downstream_gene_variant ; 272.0bp to feature; MODIFIER silent_mutation Average:79.116; most accessible tissue: Minghui63 flag leaf, score: 89.016 N N N N
vg0910844273 C -> T LOC_Os09g17730-LOC_Os09g17740 intergenic_region ; MODIFIER silent_mutation Average:79.116; most accessible tissue: Minghui63 flag leaf, score: 89.016 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0910844273 C T -0.03 -0.01 -0.01 -0.01 -0.02 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910844273 NA 2.74E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910844273 NA 1.17E-06 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910844273 4.12E-06 6.08E-14 mr1180 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910844273 NA 6.81E-14 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910844273 NA 4.12E-14 mr1503 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910844273 NA 7.61E-08 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910844273 NA 3.83E-12 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910844273 NA 1.04E-11 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910844273 NA 9.93E-11 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251