Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910822833:

Variant ID: vg0910822833 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 10822833
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATACTGAAAAGATAAACTTCTTAATTTGTGAGTCGAGAGAGCATGTAGAAAATTATTAAGAAGTATTTTTATTTATAAAGCATAATGTAGAAATTAATTT[A/C]
TTTTATAAAGTTTTACTGTTATAAATTGACCAAATCCATTCTTAAATAATTAAGATCATCTGCTTCTGAAAAAGACATGAAATAATTAGATAACCCCCCT

Reverse complement sequence

AGGGGGGTTATCTAATTATTTCATGTCTTTTTCAGAAGCAGATGATCTTAATTATTTAAGAATGGATTTGGTCAATTTATAACAGTAAAACTTTATAAAA[T/G]
AAATTAATTTCTACATTATGCTTTATAAATAAAAATACTTCTTAATAATTTTCTACATGCTCTCTCGACTCACAAATTAAGAAGTTTATCTTTTCAGTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.20%	38.30%	0.47%	11.00%	NA
All Indica	2759	80.50%	6.10%	0.43%	12.90%	NA
All Japonica	1512	3.80%	89.70%	0.20%	6.28%	NA
Aus	269	3.30%	83.60%	1.12%	11.90%	NA
Indica I	595	76.80%	11.30%	0.84%	11.09%	NA
Indica II	465	89.70%	7.50%	0.43%	2.37%	NA
Indica III	913	76.50%	1.90%	0.22%	21.47%	NA
Indica Intermediate	786	82.70%	6.40%	0.38%	10.56%	NA
Temperate Japonica	767	4.40%	89.20%	0.00%	6.39%	NA
Tropical Japonica	504	3.60%	94.00%	0.00%	2.38%	NA
Japonica Intermediate	241	2.50%	82.20%	1.24%	14.11%	NA
VI/Aromatic	96	44.80%	21.90%	2.08%	31.25%	NA
Intermediate	90	44.40%	45.60%	2.22%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0910822833	A -> DEL	N	N	silent_mutation	Average:22.757; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0910822833	A -> C	LOC_Os09g17690.1	upstream_gene_variant ; 700.0bp to feature; MODIFIER	silent_mutation	Average:22.757; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0910822833	A -> C	LOC_Os09g17700.1	upstream_gene_variant ; 3181.0bp to feature; MODIFIER	silent_mutation	Average:22.757; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0910822833	A -> C	LOC_Os09g17690-LOC_Os09g17700	intergenic_region ; MODIFIER	silent_mutation	Average:22.757; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0910822833	NA	8.40E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910822833	NA	1.49E-12	mr1579	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910822833	NA	5.02E-24	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910822833	NA	3.66E-13	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910822833	NA	2.50E-17	mr1641	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910822833	NA	7.23E-12	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910822833	NA	5.41E-06	mr1832	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910822833	NA	8.65E-23	mr1838	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910822833	NA	4.80E-23	mr1839	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910822833	NA	6.62E-16	mr1909	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910822833	NA	8.86E-12	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910822833	NA	4.52E-16	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910822833	NA	6.15E-16	mr1557_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910822833	NA	5.75E-13	mr1636_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910822833	NA	7.78E-12	mr1641_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910822833	NA	1.49E-15	mr1767_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910822833	NA	7.38E-14	mr1838_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910822833	NA	8.96E-08	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251