\
| Variant ID: vg0910822833 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 10822833 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATACTGAAAAGATAAACTTCTTAATTTGTGAGTCGAGAGAGCATGTAGAAAATTATTAAGAAGTATTTTTATTTATAAAGCATAATGTAGAAATTAATTT[A/C]
TTTTATAAAGTTTTACTGTTATAAATTGACCAAATCCATTCTTAAATAATTAAGATCATCTGCTTCTGAAAAAGACATGAAATAATTAGATAACCCCCCT
AGGGGGGTTATCTAATTATTTCATGTCTTTTTCAGAAGCAGATGATCTTAATTATTTAAGAATGGATTTGGTCAATTTATAACAGTAAAACTTTATAAAA[T/G]
AAATTAATTTCTACATTATGCTTTATAAATAAAAATACTTCTTAATAATTTTCTACATGCTCTCTCGACTCACAAATTAAGAAGTTTATCTTTTCAGTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.20% | 38.30% | 0.47% | 11.00% | NA |
| All Indica | 2759 | 80.50% | 6.10% | 0.43% | 12.90% | NA |
| All Japonica | 1512 | 3.80% | 89.70% | 0.20% | 6.28% | NA |
| Aus | 269 | 3.30% | 83.60% | 1.12% | 11.90% | NA |
| Indica I | 595 | 76.80% | 11.30% | 0.84% | 11.09% | NA |
| Indica II | 465 | 89.70% | 7.50% | 0.43% | 2.37% | NA |
| Indica III | 913 | 76.50% | 1.90% | 0.22% | 21.47% | NA |
| Indica Intermediate | 786 | 82.70% | 6.40% | 0.38% | 10.56% | NA |
| Temperate Japonica | 767 | 4.40% | 89.20% | 0.00% | 6.39% | NA |
| Tropical Japonica | 504 | 3.60% | 94.00% | 0.00% | 2.38% | NA |
| Japonica Intermediate | 241 | 2.50% | 82.20% | 1.24% | 14.11% | NA |
| VI/Aromatic | 96 | 44.80% | 21.90% | 2.08% | 31.25% | NA |
| Intermediate | 90 | 44.40% | 45.60% | 2.22% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0910822833 | A -> DEL | N | N | silent_mutation | Average:22.757; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0910822833 | A -> C | LOC_Os09g17690.1 | upstream_gene_variant ; 700.0bp to feature; MODIFIER | silent_mutation | Average:22.757; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0910822833 | A -> C | LOC_Os09g17700.1 | upstream_gene_variant ; 3181.0bp to feature; MODIFIER | silent_mutation | Average:22.757; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0910822833 | A -> C | LOC_Os09g17690-LOC_Os09g17700 | intergenic_region ; MODIFIER | silent_mutation | Average:22.757; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0910822833 | NA | 8.40E-08 | mr1506 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910822833 | NA | 1.49E-12 | mr1579 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910822833 | NA | 5.02E-24 | mr1627 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910822833 | NA | 3.66E-13 | mr1636 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910822833 | NA | 2.50E-17 | mr1641 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910822833 | NA | 7.23E-12 | mr1683 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910822833 | NA | 5.41E-06 | mr1832 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910822833 | NA | 8.65E-23 | mr1838 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910822833 | NA | 4.80E-23 | mr1839 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910822833 | NA | 6.62E-16 | mr1909 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910822833 | NA | 8.86E-12 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910822833 | NA | 4.52E-16 | mr1968 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910822833 | NA | 6.15E-16 | mr1557_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910822833 | NA | 5.75E-13 | mr1636_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910822833 | NA | 7.78E-12 | mr1641_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910822833 | NA | 1.49E-15 | mr1767_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910822833 | NA | 7.38E-14 | mr1838_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910822833 | NA | 8.96E-08 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |