Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910805763:

Variant ID: vg0910805763 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 10805763
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 345. )

Flanking Sequence (100 bp) in Reference Genome:

GGCACTCGTACACAAGCAGCCGCTGCAAGCATGGAAATCCAAGTCTCCCATCACCACATATTTTGTAAAGATCCTTGAGATGACTTAGCCCGAGGTGCCT[G/A]
AGGCGAGGAAATGATGATGAAGCTGTTGCCGATGGCATGGTGGTATCTTCCTCATCATCATCACTCACTACCTCCAACAGTGAGTTGCAGTTGTATAAAT

Reverse complement sequence

ATTTATACAACTGCAACTCACTGTTGGAGGTAGTGAGTGATGATGATGAGGAAGATACCACCATGCCATCGGCAACAGCTTCATCATCATTTCCTCGCCT[C/T]
AGGCACCTCGGGCTAAGTCATCTCAAGGATCTTTACAAAATATGTGGTGATGGGAGACTTGGATTTCCATGCTTGCAGCGGCTGCTTGTGTACGAGTGCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.00%	11.90%	0.15%	0.00%	NA
All Indica	2759	98.40%	1.60%	0.04%	0.00%	NA
All Japonica	1512	68.60%	31.00%	0.40%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	94.50%	5.40%	0.17%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.00%	1.00%	0.00%	0.00%	NA
Temperate Japonica	767	81.50%	18.10%	0.39%	0.00%	NA
Tropical Japonica	504	61.10%	38.70%	0.20%	0.00%	NA
Japonica Intermediate	241	43.20%	56.00%	0.83%	0.00%	NA
VI/Aromatic	96	68.80%	31.20%	0.00%	0.00%	NA
Intermediate	90	83.30%	16.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0910805763	G -> A	LOC_Os09g17660.1	downstream_gene_variant ; 3383.0bp to feature; MODIFIER	silent_mutation	Average:70.529; most accessible tissue: Callus, score: 79.566	N	N	N	N
vg0910805763	G -> A	LOC_Os09g17670.1	downstream_gene_variant ; 938.0bp to feature; MODIFIER	silent_mutation	Average:70.529; most accessible tissue: Callus, score: 79.566	N	N	N	N
vg0910805763	G -> A	LOC_Os09g17680.1	downstream_gene_variant ; 4372.0bp to feature; MODIFIER	silent_mutation	Average:70.529; most accessible tissue: Callus, score: 79.566	N	N	N	N
vg0910805763	G -> A	LOC_Os09g17670-LOC_Os09g17680	intergenic_region ; MODIFIER	silent_mutation	Average:70.529; most accessible tissue: Callus, score: 79.566	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0910805763	NA	2.79E-06	mr1069	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910805763	NA	9.26E-14	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910805763	NA	4.86E-14	mr1183	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910805763	NA	5.85E-14	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910805763	NA	1.13E-06	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910805763	NA	4.24E-08	mr1794	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910805763	NA	5.24E-13	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910805763	NA	2.10E-12	mr1183_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910805763	NA	3.90E-06	mr1531_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910805763	NA	5.42E-12	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910805763	NA	9.89E-06	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251