\
| Variant ID: vg0910805763 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 10805763 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 345. )
GGCACTCGTACACAAGCAGCCGCTGCAAGCATGGAAATCCAAGTCTCCCATCACCACATATTTTGTAAAGATCCTTGAGATGACTTAGCCCGAGGTGCCT[G/A]
AGGCGAGGAAATGATGATGAAGCTGTTGCCGATGGCATGGTGGTATCTTCCTCATCATCATCACTCACTACCTCCAACAGTGAGTTGCAGTTGTATAAAT
ATTTATACAACTGCAACTCACTGTTGGAGGTAGTGAGTGATGATGATGAGGAAGATACCACCATGCCATCGGCAACAGCTTCATCATCATTTCCTCGCCT[C/T]
AGGCACCTCGGGCTAAGTCATCTCAAGGATCTTTACAAAATATGTGGTGATGGGAGACTTGGATTTCCATGCTTGCAGCGGCTGCTTGTGTACGAGTGCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.00% | 11.90% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 98.40% | 1.60% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 68.60% | 31.00% | 0.40% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.50% | 5.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 81.50% | 18.10% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 61.10% | 38.70% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 43.20% | 56.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 68.80% | 31.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0910805763 | G -> A | LOC_Os09g17660.1 | downstream_gene_variant ; 3383.0bp to feature; MODIFIER | silent_mutation | Average:70.529; most accessible tissue: Callus, score: 79.566 | N | N | N | N |
| vg0910805763 | G -> A | LOC_Os09g17670.1 | downstream_gene_variant ; 938.0bp to feature; MODIFIER | silent_mutation | Average:70.529; most accessible tissue: Callus, score: 79.566 | N | N | N | N |
| vg0910805763 | G -> A | LOC_Os09g17680.1 | downstream_gene_variant ; 4372.0bp to feature; MODIFIER | silent_mutation | Average:70.529; most accessible tissue: Callus, score: 79.566 | N | N | N | N |
| vg0910805763 | G -> A | LOC_Os09g17670-LOC_Os09g17680 | intergenic_region ; MODIFIER | silent_mutation | Average:70.529; most accessible tissue: Callus, score: 79.566 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0910805763 | NA | 2.79E-06 | mr1069 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910805763 | NA | 9.26E-14 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910805763 | NA | 4.86E-14 | mr1183 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910805763 | NA | 5.85E-14 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910805763 | NA | 1.13E-06 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910805763 | NA | 4.24E-08 | mr1794 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910805763 | NA | 5.24E-13 | mr1180_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910805763 | NA | 2.10E-12 | mr1183_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910805763 | NA | 3.90E-06 | mr1531_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910805763 | NA | 5.42E-12 | mr1794_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910805763 | NA | 9.89E-06 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |