\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910805763:

Variant ID: vg0910805763 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10805763
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 345. )

Flanking Sequence (100 bp) in Reference Genome:


GGCACTCGTACACAAGCAGCCGCTGCAAGCATGGAAATCCAAGTCTCCCATCACCACATATTTTGTAAAGATCCTTGAGATGACTTAGCCCGAGGTGCCT[G/A]
AGGCGAGGAAATGATGATGAAGCTGTTGCCGATGGCATGGTGGTATCTTCCTCATCATCATCACTCACTACCTCCAACAGTGAGTTGCAGTTGTATAAAT

Reverse complement sequence

ATTTATACAACTGCAACTCACTGTTGGAGGTAGTGAGTGATGATGATGAGGAAGATACCACCATGCCATCGGCAACAGCTTCATCATCATTTCCTCGCCT[C/T]
AGGCACCTCGGGCTAAGTCATCTCAAGGATCTTTACAAAATATGTGGTGATGGGAGACTTGGATTTCCATGCTTGCAGCGGCTGCTTGTGTACGAGTGCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.00% 11.90% 0.15% 0.00% NA
All Indica  2759 98.40% 1.60% 0.04% 0.00% NA
All Japonica  1512 68.60% 31.00% 0.40% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 94.50% 5.40% 0.17% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.00% 1.00% 0.00% 0.00% NA
Temperate Japonica  767 81.50% 18.10% 0.39% 0.00% NA
Tropical Japonica  504 61.10% 38.70% 0.20% 0.00% NA
Japonica Intermediate  241 43.20% 56.00% 0.83% 0.00% NA
VI/Aromatic  96 68.80% 31.20% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910805763 G -> A LOC_Os09g17660.1 downstream_gene_variant ; 3383.0bp to feature; MODIFIER silent_mutation Average:70.529; most accessible tissue: Callus, score: 79.566 N N N N
vg0910805763 G -> A LOC_Os09g17670.1 downstream_gene_variant ; 938.0bp to feature; MODIFIER silent_mutation Average:70.529; most accessible tissue: Callus, score: 79.566 N N N N
vg0910805763 G -> A LOC_Os09g17680.1 downstream_gene_variant ; 4372.0bp to feature; MODIFIER silent_mutation Average:70.529; most accessible tissue: Callus, score: 79.566 N N N N
vg0910805763 G -> A LOC_Os09g17670-LOC_Os09g17680 intergenic_region ; MODIFIER silent_mutation Average:70.529; most accessible tissue: Callus, score: 79.566 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910805763 NA 2.79E-06 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910805763 NA 9.26E-14 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910805763 NA 4.86E-14 mr1183 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910805763 NA 5.85E-14 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910805763 NA 1.13E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910805763 NA 4.24E-08 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910805763 NA 5.24E-13 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910805763 NA 2.10E-12 mr1183_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910805763 NA 3.90E-06 mr1531_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910805763 NA 5.42E-12 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910805763 NA 9.89E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251