\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910796349:

Variant ID: vg0910796349 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10796349
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACTTGACTCATTAGTAGCAAACAACAGTATTACATATGCATAGTATCAATCTAGAAGCCATAAATATGAAACAATCACAGATATCCAAATAAACAACCC[G/A]
AAACCGAAACCGACACAGCGTCGGCCGGTCAGACCGCGGGCTGCGCCGGTCTGACCGGGCAATACAAGCTGGTCTGACTGGCAGCACATGCCCGGTCTGA

Reverse complement sequence

TCAGACCGGGCATGTGCTGCCAGTCAGACCAGCTTGTATTGCCCGGTCAGACCGGCGCAGCCCGCGGTCTGACCGGCCGACGCTGTGTCGGTTTCGGTTT[C/T]
GGGTTGTTTATTTGGATATCTGTGATTGTTTCATATTTATGGCTTCTAGATTGATACTATGCATATGTAATACTGTTGTTTGCTACTAATGAGTCAAGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.60% 7.70% 2.37% 14.37% NA
All Indica  2759 80.80% 0.20% 2.03% 16.96% NA
All Japonica  1512 74.70% 23.10% 1.59% 0.60% NA
Aus  269 21.60% 0.00% 10.41% 68.03% NA
Indica I  595 86.90% 0.00% 1.18% 11.93% NA
Indica II  465 57.40% 0.40% 4.09% 38.06% NA
Indica III  913 93.10% 0.10% 0.99% 5.81% NA
Indica Intermediate  786 75.80% 0.30% 2.67% 21.25% NA
Temperate Japonica  767 89.40% 9.60% 0.52% 0.39% NA
Tropical Japonica  504 58.50% 37.30% 3.57% 0.60% NA
Japonica Intermediate  241 61.80% 36.10% 0.83% 1.24% NA
VI/Aromatic  96 86.50% 0.00% 3.12% 10.42% NA
Intermediate  90 80.00% 8.90% 1.11% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910796349 G -> DEL N N silent_mutation Average:50.074; most accessible tissue: Minghui63 flag leaf, score: 70.17 N N N N
vg0910796349 G -> A LOC_Os09g17650.1 upstream_gene_variant ; 1670.0bp to feature; MODIFIER silent_mutation Average:50.074; most accessible tissue: Minghui63 flag leaf, score: 70.17 N N N N
vg0910796349 G -> A LOC_Os09g17660.1 upstream_gene_variant ; 4705.0bp to feature; MODIFIER silent_mutation Average:50.074; most accessible tissue: Minghui63 flag leaf, score: 70.17 N N N N
vg0910796349 G -> A LOC_Os09g17630.1 downstream_gene_variant ; 2480.0bp to feature; MODIFIER silent_mutation Average:50.074; most accessible tissue: Minghui63 flag leaf, score: 70.17 N N N N
vg0910796349 G -> A LOC_Os09g17640.1 intron_variant ; MODIFIER silent_mutation Average:50.074; most accessible tissue: Minghui63 flag leaf, score: 70.17 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910796349 NA 8.59E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910796349 NA 7.92E-08 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910796349 NA 2.42E-08 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910796349 NA 1.96E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910796349 7.56E-06 NA mr1794 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910796349 NA 1.09E-08 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910796349 NA 3.16E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910796349 NA 1.93E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910796349 NA 3.91E-09 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910796349 NA 3.02E-07 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251