Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910796349:

Variant ID: vg0910796349 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 10796349
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACTTGACTCATTAGTAGCAAACAACAGTATTACATATGCATAGTATCAATCTAGAAGCCATAAATATGAAACAATCACAGATATCCAAATAAACAACCC[G/A]
AAACCGAAACCGACACAGCGTCGGCCGGTCAGACCGCGGGCTGCGCCGGTCTGACCGGGCAATACAAGCTGGTCTGACTGGCAGCACATGCCCGGTCTGA

Reverse complement sequence

TCAGACCGGGCATGTGCTGCCAGTCAGACCAGCTTGTATTGCCCGGTCAGACCGGCGCAGCCCGCGGTCTGACCGGCCGACGCTGTGTCGGTTTCGGTTT[C/T]
GGGTTGTTTATTTGGATATCTGTGATTGTTTCATATTTATGGCTTCTAGATTGATACTATGCATATGTAATACTGTTGTTTGCTACTAATGAGTCAAGTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.60%	7.70%	2.37%	14.37%	NA
All Indica	2759	80.80%	0.20%	2.03%	16.96%	NA
All Japonica	1512	74.70%	23.10%	1.59%	0.60%	NA
Aus	269	21.60%	0.00%	10.41%	68.03%	NA
Indica I	595	86.90%	0.00%	1.18%	11.93%	NA
Indica II	465	57.40%	0.40%	4.09%	38.06%	NA
Indica III	913	93.10%	0.10%	0.99%	5.81%	NA
Indica Intermediate	786	75.80%	0.30%	2.67%	21.25%	NA
Temperate Japonica	767	89.40%	9.60%	0.52%	0.39%	NA
Tropical Japonica	504	58.50%	37.30%	3.57%	0.60%	NA
Japonica Intermediate	241	61.80%	36.10%	0.83%	1.24%	NA
VI/Aromatic	96	86.50%	0.00%	3.12%	10.42%	NA
Intermediate	90	80.00%	8.90%	1.11%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0910796349	G -> DEL	N	N	silent_mutation	Average:50.074; most accessible tissue: Minghui63 flag leaf, score: 70.17	N	N	N	N
vg0910796349	G -> A	LOC_Os09g17650.1	upstream_gene_variant ; 1670.0bp to feature; MODIFIER	silent_mutation	Average:50.074; most accessible tissue: Minghui63 flag leaf, score: 70.17	N	N	N	N
vg0910796349	G -> A	LOC_Os09g17660.1	upstream_gene_variant ; 4705.0bp to feature; MODIFIER	silent_mutation	Average:50.074; most accessible tissue: Minghui63 flag leaf, score: 70.17	N	N	N	N
vg0910796349	G -> A	LOC_Os09g17630.1	downstream_gene_variant ; 2480.0bp to feature; MODIFIER	silent_mutation	Average:50.074; most accessible tissue: Minghui63 flag leaf, score: 70.17	N	N	N	N
vg0910796349	G -> A	LOC_Os09g17640.1	intron_variant ; MODIFIER	silent_mutation	Average:50.074; most accessible tissue: Minghui63 flag leaf, score: 70.17	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0910796349	NA	8.59E-06	mr1063	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910796349	NA	7.92E-08	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910796349	NA	2.42E-08	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910796349	NA	1.96E-07	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910796349	7.56E-06	NA	mr1794	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910796349	NA	1.09E-08	mr1794	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910796349	NA	3.16E-08	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910796349	NA	1.93E-07	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910796349	NA	3.91E-09	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910796349	NA	3.02E-07	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251