\
| Variant ID: vg0910796349 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 10796349 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AACTTGACTCATTAGTAGCAAACAACAGTATTACATATGCATAGTATCAATCTAGAAGCCATAAATATGAAACAATCACAGATATCCAAATAAACAACCC[G/A]
AAACCGAAACCGACACAGCGTCGGCCGGTCAGACCGCGGGCTGCGCCGGTCTGACCGGGCAATACAAGCTGGTCTGACTGGCAGCACATGCCCGGTCTGA
TCAGACCGGGCATGTGCTGCCAGTCAGACCAGCTTGTATTGCCCGGTCAGACCGGCGCAGCCCGCGGTCTGACCGGCCGACGCTGTGTCGGTTTCGGTTT[C/T]
GGGTTGTTTATTTGGATATCTGTGATTGTTTCATATTTATGGCTTCTAGATTGATACTATGCATATGTAATACTGTTGTTTGCTACTAATGAGTCAAGTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.60% | 7.70% | 2.37% | 14.37% | NA |
| All Indica | 2759 | 80.80% | 0.20% | 2.03% | 16.96% | NA |
| All Japonica | 1512 | 74.70% | 23.10% | 1.59% | 0.60% | NA |
| Aus | 269 | 21.60% | 0.00% | 10.41% | 68.03% | NA |
| Indica I | 595 | 86.90% | 0.00% | 1.18% | 11.93% | NA |
| Indica II | 465 | 57.40% | 0.40% | 4.09% | 38.06% | NA |
| Indica III | 913 | 93.10% | 0.10% | 0.99% | 5.81% | NA |
| Indica Intermediate | 786 | 75.80% | 0.30% | 2.67% | 21.25% | NA |
| Temperate Japonica | 767 | 89.40% | 9.60% | 0.52% | 0.39% | NA |
| Tropical Japonica | 504 | 58.50% | 37.30% | 3.57% | 0.60% | NA |
| Japonica Intermediate | 241 | 61.80% | 36.10% | 0.83% | 1.24% | NA |
| VI/Aromatic | 96 | 86.50% | 0.00% | 3.12% | 10.42% | NA |
| Intermediate | 90 | 80.00% | 8.90% | 1.11% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0910796349 | G -> DEL | N | N | silent_mutation | Average:50.074; most accessible tissue: Minghui63 flag leaf, score: 70.17 | N | N | N | N |
| vg0910796349 | G -> A | LOC_Os09g17650.1 | upstream_gene_variant ; 1670.0bp to feature; MODIFIER | silent_mutation | Average:50.074; most accessible tissue: Minghui63 flag leaf, score: 70.17 | N | N | N | N |
| vg0910796349 | G -> A | LOC_Os09g17660.1 | upstream_gene_variant ; 4705.0bp to feature; MODIFIER | silent_mutation | Average:50.074; most accessible tissue: Minghui63 flag leaf, score: 70.17 | N | N | N | N |
| vg0910796349 | G -> A | LOC_Os09g17630.1 | downstream_gene_variant ; 2480.0bp to feature; MODIFIER | silent_mutation | Average:50.074; most accessible tissue: Minghui63 flag leaf, score: 70.17 | N | N | N | N |
| vg0910796349 | G -> A | LOC_Os09g17640.1 | intron_variant ; MODIFIER | silent_mutation | Average:50.074; most accessible tissue: Minghui63 flag leaf, score: 70.17 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0910796349 | NA | 8.59E-06 | mr1063 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910796349 | NA | 7.92E-08 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910796349 | NA | 2.42E-08 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910796349 | NA | 1.96E-07 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910796349 | 7.56E-06 | NA | mr1794 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910796349 | NA | 1.09E-08 | mr1794 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910796349 | NA | 3.16E-08 | mr1180_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910796349 | NA | 1.93E-07 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910796349 | NA | 3.91E-09 | mr1794_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910796349 | NA | 3.02E-07 | mr1966_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |