Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910781140:

Variant ID: vg0910781140 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 10781140
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATCCATCCACTTTTAGGTCTCGTGCGCTACCTCCTTTTATTATTGCCGAATTCATGTTTCGACAGGCATATATGTGTCTAGATTCATTAACTTGTATAT[A/G]
AATATGGGCAATGCTAGAAAGTTTTATATTGTGAAACGGAGAATGTACCATCTTATCATGGCCAGATTCTGACTGCGTTGTTTTGGGCTTACTGCGGAAC

Reverse complement sequence

GTTCCGCAGTAAGCCCAAAACAACGCAGTCAGAATCTGGCCATGATAAGATGGTACATTCTCCGTTTCACAATATAAAACTTTCTAGCATTGCCCATATT[T/C]
ATATACAAGTTAATGAATCTAGACACATATATGCCTGTCGAAACATGAATTCGGCAATAATAAAAGGAGGTAGCGCACGAGACCTAAAAGTGGATGGATG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.50%	31.00%	10.28%	6.22%	NA
All Indica	2759	45.30%	28.30%	16.78%	9.57%	NA
All Japonica	1512	72.30%	25.90%	0.26%	1.52%	NA
Aus	269	4.80%	93.30%	1.49%	0.37%	NA
Indica I	595	74.50%	8.60%	8.07%	8.91%	NA
Indica II	465	26.90%	23.20%	31.40%	18.49%	NA
Indica III	913	36.50%	48.60%	12.27%	2.63%	NA
Indica Intermediate	786	44.50%	22.60%	19.97%	12.85%	NA
Temperate Japonica	767	86.20%	13.20%	0.39%	0.26%	NA
Tropical Japonica	504	56.20%	39.70%	0.00%	4.17%	NA
Japonica Intermediate	241	61.80%	37.80%	0.41%	0.00%	NA
VI/Aromatic	96	72.90%	20.80%	5.21%	1.04%	NA
Intermediate	90	62.20%	21.10%	11.11%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0910781140	A -> G	LOC_Os09g17630.1	upstream_gene_variant ; 4070.0bp to feature; MODIFIER	silent_mutation	Average:47.166; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg0910781140	A -> G	LOC_Os09g17620-LOC_Os09g17630	intergenic_region ; MODIFIER	silent_mutation	Average:47.166; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg0910781140	A -> DEL	N	N	silent_mutation	Average:47.166; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0910781140	NA	2.70E-06	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910781140	NA	3.79E-07	mr1794	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910781140	NA	9.92E-08	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910781140	NA	2.57E-11	mr1879_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251