\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910781014:

Variant ID: vg0910781014 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10781014
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTAGGGGGCATGAGACAACTAGATCGTCAGATTTATAATTTACCCGGCGGATTTAAATCCGCAAACAGGAGTAGGGTATTACCTCTCATTGAGAGGGCCT[G/A]
AACCTGTCTAAATCTTTTATCTCCGCATCCATCCACTTTTAGGTCTCGTGCGCTACCTCCTTTTATTATTGCCGAATTCATGTTTCGACAGGCATATATG

Reverse complement sequence

CATATATGCCTGTCGAAACATGAATTCGGCAATAATAAAAGGAGGTAGCGCACGAGACCTAAAAGTGGATGGATGCGGAGATAAAAGATTTAGACAGGTT[C/T]
AGGCCCTCTCAATGAGAGGTAATACCCTACTCCTGTTTGCGGATTTAAATCCGCCGGGTAAATTATAAATCTGACGATCTAGTTGTCTCATGCCCCCTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.00% 7.60% 25.84% 36.61% NA
All Indica  2759 6.80% 0.10% 32.51% 60.57% NA
All Japonica  1512 72.40% 22.70% 4.30% 0.60% NA
Aus  269 7.80% 0.00% 81.41% 10.78% NA
Indica I  595 14.10% 0.00% 12.10% 73.78% NA
Indica II  465 3.90% 0.40% 44.52% 51.18% NA
Indica III  913 2.30% 0.00% 40.64% 57.06% NA
Indica Intermediate  786 8.10% 0.30% 31.42% 60.18% NA
Temperate Japonica  767 86.60% 9.50% 3.91% 0.00% NA
Tropical Japonica  504 56.20% 36.30% 5.95% 1.59% NA
Japonica Intermediate  241 61.40% 36.10% 2.07% 0.41% NA
VI/Aromatic  96 71.90% 0.00% 20.83% 7.29% NA
Intermediate  90 50.00% 12.20% 22.22% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910781014 G -> DEL N N silent_mutation Average:32.803; most accessible tissue: Callus, score: 44.052 N N N N
vg0910781014 G -> A LOC_Os09g17630.1 upstream_gene_variant ; 4196.0bp to feature; MODIFIER silent_mutation Average:32.803; most accessible tissue: Callus, score: 44.052 N N N N
vg0910781014 G -> A LOC_Os09g17620-LOC_Os09g17630 intergenic_region ; MODIFIER silent_mutation Average:32.803; most accessible tissue: Callus, score: 44.052 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910781014 NA 9.67E-08 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910781014 NA 3.83E-08 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910781014 NA 1.94E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910781014 NA 1.69E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910781014 1.92E-06 7.54E-10 mr1794 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910781014 NA 1.32E-08 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910781014 NA 3.25E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910781014 NA 1.42E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910781014 NA 1.71E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251