\
| Variant ID: vg0910781014 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 10781014 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTAGGGGGCATGAGACAACTAGATCGTCAGATTTATAATTTACCCGGCGGATTTAAATCCGCAAACAGGAGTAGGGTATTACCTCTCATTGAGAGGGCCT[G/A]
AACCTGTCTAAATCTTTTATCTCCGCATCCATCCACTTTTAGGTCTCGTGCGCTACCTCCTTTTATTATTGCCGAATTCATGTTTCGACAGGCATATATG
CATATATGCCTGTCGAAACATGAATTCGGCAATAATAAAAGGAGGTAGCGCACGAGACCTAAAAGTGGATGGATGCGGAGATAAAAGATTTAGACAGGTT[C/T]
AGGCCCTCTCAATGAGAGGTAATACCCTACTCCTGTTTGCGGATTTAAATCCGCCGGGTAAATTATAAATCTGACGATCTAGTTGTCTCATGCCCCCTAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.00% | 7.60% | 25.84% | 36.61% | NA |
| All Indica | 2759 | 6.80% | 0.10% | 32.51% | 60.57% | NA |
| All Japonica | 1512 | 72.40% | 22.70% | 4.30% | 0.60% | NA |
| Aus | 269 | 7.80% | 0.00% | 81.41% | 10.78% | NA |
| Indica I | 595 | 14.10% | 0.00% | 12.10% | 73.78% | NA |
| Indica II | 465 | 3.90% | 0.40% | 44.52% | 51.18% | NA |
| Indica III | 913 | 2.30% | 0.00% | 40.64% | 57.06% | NA |
| Indica Intermediate | 786 | 8.10% | 0.30% | 31.42% | 60.18% | NA |
| Temperate Japonica | 767 | 86.60% | 9.50% | 3.91% | 0.00% | NA |
| Tropical Japonica | 504 | 56.20% | 36.30% | 5.95% | 1.59% | NA |
| Japonica Intermediate | 241 | 61.40% | 36.10% | 2.07% | 0.41% | NA |
| VI/Aromatic | 96 | 71.90% | 0.00% | 20.83% | 7.29% | NA |
| Intermediate | 90 | 50.00% | 12.20% | 22.22% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0910781014 | G -> DEL | N | N | silent_mutation | Average:32.803; most accessible tissue: Callus, score: 44.052 | N | N | N | N |
| vg0910781014 | G -> A | LOC_Os09g17630.1 | upstream_gene_variant ; 4196.0bp to feature; MODIFIER | silent_mutation | Average:32.803; most accessible tissue: Callus, score: 44.052 | N | N | N | N |
| vg0910781014 | G -> A | LOC_Os09g17620-LOC_Os09g17630 | intergenic_region ; MODIFIER | silent_mutation | Average:32.803; most accessible tissue: Callus, score: 44.052 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0910781014 | NA | 9.67E-08 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910781014 | NA | 3.83E-08 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910781014 | NA | 1.94E-07 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910781014 | NA | 1.69E-06 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910781014 | 1.92E-06 | 7.54E-10 | mr1794 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910781014 | NA | 1.32E-08 | mr1794 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910781014 | NA | 3.25E-08 | mr1180_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910781014 | NA | 1.42E-07 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910781014 | NA | 1.71E-08 | mr1794_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |