Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910780392:

Variant ID: vg0910780392 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 10780392
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.78, C: 0.21, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

TTTAGGTTACATCATATTTTACAAAGCAGTCGGTATATCACTCGGATCATGTTATTCAGGGATTCACACCGCATATGCTACATATTAATATCAAGTCGCT[C/T]
GGTTGACTATAATTATCGAAGCCACTCGGTTGGTTGGATTATTTATTCCTTGACTATATGCTTGGTTTGTTCAATTAACCATATAGTCGAGGGCTACACC

Reverse complement sequence

GGTGTAGCCCTCGACTATATGGTTAATTGAACAAACCAAGCATATAGTCAAGGAATAAATAATCCAACCAACCGAGTGGCTTCGATAATTATAGTCAACC[G/A]
AGCGACTTGATATTAATATGTAGCATATGCGGTGTGAATCCCTGAATAACATGATCCGAGTGATATACCGACTGCTTTGTAAAATATGATGTAACCTAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.20%	13.50%	38.13%	20.17%	NA
All Indica	2759	4.00%	4.80%	58.03%	33.16%	NA
All Japonica	1512	72.60%	17.30%	8.66%	1.39%	NA
Aus	269	4.50%	79.90%	15.61%	0.00%	NA
Indica I	595	10.10%	3.50%	40.84%	45.55%	NA
Indica II	465	2.80%	6.90%	57.63%	32.69%	NA
Indica III	913	0.80%	3.90%	72.29%	23.00%	NA
Indica Intermediate	786	3.90%	5.50%	54.71%	35.88%	NA
Temperate Japonica	767	86.60%	5.60%	6.91%	0.91%	NA
Tropical Japonica	504	56.70%	29.80%	11.90%	1.59%	NA
Japonica Intermediate	241	61.40%	28.60%	7.47%	2.49%	NA
VI/Aromatic	96	70.80%	14.60%	11.46%	3.12%	NA
Intermediate	90	50.00%	15.60%	18.89%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0910780392	C -> DEL	N	N	silent_mutation	Average:17.78; most accessible tissue: Minghui63 root, score: 33.152	N	N	N	N
vg0910780392	C -> T	LOC_Os09g17630.1	upstream_gene_variant ; 4818.0bp to feature; MODIFIER	silent_mutation	Average:17.78; most accessible tissue: Minghui63 root, score: 33.152	N	N	N	N
vg0910780392	C -> T	LOC_Os09g17620-LOC_Os09g17630	intergenic_region ; MODIFIER	silent_mutation	Average:17.78; most accessible tissue: Minghui63 root, score: 33.152	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0910780392	NA	9.41E-07	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910780392	NA	1.85E-07	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910780392	NA	7.44E-07	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910780392	1.49E-06	NA	mr1518	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910780392	5.32E-06	NA	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910780392	NA	7.53E-09	mr1794	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910780392	NA	1.28E-07	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910780392	NA	1.40E-07	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910780392	NA	4.77E-07	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910780392	NA	1.77E-08	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251