\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910745951:

Variant ID: vg0910745951 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10745951
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.02, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


TATGAGAGATCCTAGGATAGAGTCCGACTCCTACTCTAGTCCTACACCTATTACAACTCCAAGTCCTAAACTGTAACCGATTGTGTACACATATTCGACA[C/A,T]
AAACTCTAACAAACTCCACCTTGGCGAATATACCACGCCAATCCGAATCTGTTACTTGCTCGAACCTTCGTGTACCAGGACTTGAGTTGATCCTTTTTCG

Reverse complement sequence

CGAAAAAGGATCAACTCAAGTCCTGGTACACGAAGGTTCGAGCAAGTAACAGATTCGGATTGGCGTGGTATATTCGCCAAGGTGGAGTTTGTTAGAGTTT[G/T,A]
TGTCGAATATGTGTACACAATCGGTTACAGTTTAGGACTTGGAGTTGTAATAGGTGTAGGACTAGAGTAGGAGTCGGACTCTATCCTAGGATCTCTCATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.70% 26.10% 0.15% 0.00% T: 0.02%
All Indica  2759 97.90% 2.00% 0.04% 0.00% NA
All Japonica  1512 30.00% 69.60% 0.40% 0.00% NA
Aus  269 92.60% 7.10% 0.00% 0.00% T: 0.37%
Indica I  595 94.50% 5.50% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 97.80% 2.00% 0.13% 0.00% NA
Temperate Japonica  767 49.30% 50.20% 0.52% 0.00% NA
Tropical Japonica  504 8.70% 91.30% 0.00% 0.00% NA
Japonica Intermediate  241 13.30% 85.90% 0.83% 0.00% NA
VI/Aromatic  96 28.10% 71.90% 0.00% 0.00% NA
Intermediate  90 57.80% 42.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910745951 C -> T LOC_Os09g17560.1 upstream_gene_variant ; 4040.0bp to feature; MODIFIER silent_mutation Average:50.19; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 N N N N
vg0910745951 C -> T LOC_Os09g17570.1 downstream_gene_variant ; 52.0bp to feature; MODIFIER silent_mutation Average:50.19; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 N N N N
vg0910745951 C -> T LOC_Os09g17560-LOC_Os09g17570 intergenic_region ; MODIFIER silent_mutation Average:50.19; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 N N N N
vg0910745951 C -> A LOC_Os09g17560.1 upstream_gene_variant ; 4040.0bp to feature; MODIFIER silent_mutation Average:50.19; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 N N N N
vg0910745951 C -> A LOC_Os09g17570.1 downstream_gene_variant ; 52.0bp to feature; MODIFIER silent_mutation Average:50.19; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 N N N N
vg0910745951 C -> A LOC_Os09g17560-LOC_Os09g17570 intergenic_region ; MODIFIER silent_mutation Average:50.19; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910745951 NA 3.30E-12 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 3.40E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 2.67E-15 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 7.12E-15 mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 2.32E-11 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 4.58E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 1.39E-13 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 1.80E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 4.01E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 1.21E-06 6.32E-26 mr1627 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 2.36E-09 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 6.14E-13 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 1.54E-11 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 5.72E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 3.57E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 2.01E-09 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 1.98E-09 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 2.41E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 7.32E-08 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 1.91E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 1.38E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 9.34E-07 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 1.80E-08 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 4.84E-06 mr1492_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 4.76E-11 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 2.55E-15 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 2.03E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 6.05E-08 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 6.26E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 4.38E-06 mr1764_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 2.23E-07 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 6.43E-08 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 3.88E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745951 NA 1.77E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251