\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910745892:

Variant ID: vg0910745892 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10745892
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.02, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


GCCGCTCCCTCTCGCTATGCTAAGTCACCATGCGGTTACAACAGGCACGCCCCTCTATTTATGAGAGATCCTAGGATAGAGTCCGACTCCTACTCTAGTC[C/A]
TACACCTATTACAACTCCAAGTCCTAAACTGTAACCGATTGTGTACACATATTCGACACAAACTCTAACAAACTCCACCTTGGCGAATATACCACGCCAA

Reverse complement sequence

TTGGCGTGGTATATTCGCCAAGGTGGAGTTTGTTAGAGTTTGTGTCGAATATGTGTACACAATCGGTTACAGTTTAGGACTTGGAGTTGTAATAGGTGTA[G/T]
GACTAGAGTAGGAGTCGGACTCTATCCTAGGATCTCTCATAAATAGAGGGGCGTGCCTGTTGTAACCGCATGGTGACTTAGCATAGCGAGAGGGAGCGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.40% 11.60% 0.06% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 70.30% 29.60% 0.13% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.00% 1.00% 0.00% 0.00% NA
Temperate Japonica  767 84.00% 16.00% 0.00% 0.00% NA
Tropical Japonica  504 59.30% 40.70% 0.00% 0.00% NA
Japonica Intermediate  241 49.80% 49.40% 0.83% 0.00% NA
VI/Aromatic  96 35.40% 63.50% 1.04% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910745892 C -> A LOC_Os09g17560.1 upstream_gene_variant ; 3981.0bp to feature; MODIFIER silent_mutation Average:49.732; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 N N N N
vg0910745892 C -> A LOC_Os09g17570.1 downstream_gene_variant ; 111.0bp to feature; MODIFIER silent_mutation Average:49.732; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 N N N N
vg0910745892 C -> A LOC_Os09g17560-LOC_Os09g17570 intergenic_region ; MODIFIER silent_mutation Average:49.732; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910745892 NA 4.30E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745892 NA 3.00E-06 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745892 NA 6.00E-13 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745892 NA 1.61E-13 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745892 NA 4.24E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745892 NA 6.14E-13 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745892 NA 8.90E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745892 NA 1.09E-07 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745892 NA 1.72E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745892 NA 1.30E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745892 NA 2.72E-13 mr1180_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745892 NA 3.01E-12 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910745892 NA 3.34E-11 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251