\
| Variant ID: vg0910745892 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 10745892 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.02, others allele: 0.00, population size: 195. )
GCCGCTCCCTCTCGCTATGCTAAGTCACCATGCGGTTACAACAGGCACGCCCCTCTATTTATGAGAGATCCTAGGATAGAGTCCGACTCCTACTCTAGTC[C/A]
TACACCTATTACAACTCCAAGTCCTAAACTGTAACCGATTGTGTACACATATTCGACACAAACTCTAACAAACTCCACCTTGGCGAATATACCACGCCAA
TTGGCGTGGTATATTCGCCAAGGTGGAGTTTGTTAGAGTTTGTGTCGAATATGTGTACACAATCGGTTACAGTTTAGGACTTGGAGTTGTAATAGGTGTA[G/T]
GACTAGAGTAGGAGTCGGACTCTATCCTAGGATCTCTCATAAATAGAGGGGCGTGCCTGTTGTAACCGCATGGTGACTTAGCATAGCGAGAGGGAGCGGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.40% | 11.60% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 70.30% | 29.60% | 0.13% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 84.00% | 16.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 59.30% | 40.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 49.80% | 49.40% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 35.40% | 63.50% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 26.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0910745892 | C -> A | LOC_Os09g17560.1 | upstream_gene_variant ; 3981.0bp to feature; MODIFIER | silent_mutation | Average:49.732; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 | N | N | N | N |
| vg0910745892 | C -> A | LOC_Os09g17570.1 | downstream_gene_variant ; 111.0bp to feature; MODIFIER | silent_mutation | Average:49.732; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 | N | N | N | N |
| vg0910745892 | C -> A | LOC_Os09g17560-LOC_Os09g17570 | intergenic_region ; MODIFIER | silent_mutation | Average:49.732; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0910745892 | NA | 4.30E-06 | mr1063 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910745892 | NA | 3.00E-06 | mr1069 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910745892 | NA | 6.00E-13 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910745892 | NA | 1.61E-13 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910745892 | NA | 4.24E-06 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910745892 | NA | 6.14E-13 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910745892 | NA | 8.90E-07 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910745892 | NA | 1.09E-07 | mr1794 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910745892 | NA | 1.72E-06 | mr1072_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910745892 | NA | 1.30E-06 | mr1075_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910745892 | NA | 2.72E-13 | mr1180_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910745892 | NA | 3.01E-12 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910745892 | NA | 3.34E-11 | mr1794_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |