\
| Variant ID: vg0910744582 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 10744582 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.10, others allele: 0.00, population size: 105. )
ATCCAAATCCAAATTCGAGTTGGGCATAAACTGTTTGATGAAAACAAAACAATGAACACACAGAAGTAGAAAACAATGAACACACAGAAGTAGAGAAACC[G/A]
TTTATTTTATTAATAATTATTCATTAACATCAATGTTTTACAAATACAATATGTTTTCACATGAGTTCGTCTTTTGCTTTCACGAAGATGCTTAATGGAG
CTCCATTAAGCATCTTCGTGAAAGCAAAAGACGAACTCATGTGAAAACATATTGTATTTGTAAAACATTGATGTTAATGAATAATTATTAATAAAATAAA[C/T]
GGTTTCTCTACTTCTGTGTGTTCATTGTTTTCTACTTCTGTGTGTTCATTGTTTTGTTTTCATCAAACAGTTTATGCCCAACTCGAATTTGGATTTGGAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.60% | 44.10% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 84.40% | 15.30% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 0.60% | 99.30% | 0.13% | 0.00% | NA |
| Aus | 269 | 90.70% | 9.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 64.50% | 34.60% | 0.86% | 0.00% | NA |
| Indica III | 913 | 92.00% | 8.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 83.50% | 16.00% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 97.90% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 25.00% | 75.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 26.70% | 73.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0910744582 | G -> A | LOC_Os09g17560.1 | upstream_gene_variant ; 2671.0bp to feature; MODIFIER | silent_mutation | Average:38.063; most accessible tissue: Callus, score: 63.636 | N | N | N | N |
| vg0910744582 | G -> A | LOC_Os09g17570.1 | downstream_gene_variant ; 1421.0bp to feature; MODIFIER | silent_mutation | Average:38.063; most accessible tissue: Callus, score: 63.636 | N | N | N | N |
| vg0910744582 | G -> A | LOC_Os09g17560-LOC_Os09g17570 | intergenic_region ; MODIFIER | silent_mutation | Average:38.063; most accessible tissue: Callus, score: 63.636 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0910744582 | NA | 6.16E-06 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910744582 | NA | 8.42E-27 | mr1903 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910744582 | NA | 1.66E-07 | mr1004_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910744582 | NA | 2.18E-15 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910744582 | NA | 1.16E-18 | mr1168_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910744582 | NA | 1.85E-06 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910744582 | NA | 1.45E-18 | mr1712_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910744582 | NA | 7.52E-16 | mr1717_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910744582 | NA | 2.38E-06 | mr1717_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910744582 | NA | 4.39E-08 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910744582 | NA | 9.34E-16 | mr1836_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910744582 | NA | 1.56E-10 | mr1893_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910744582 | NA | 2.20E-07 | mr1895_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910744582 | NA | 2.07E-06 | mr1896_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |