Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910743892:

Variant ID: vg0910743892 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 10743892
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, C: 0.29, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTTTTGTTGTCCTTAAATACCTTTCTCTTATTAGTAGGAGTATCAAATTTAATCATTTATACTTCCTCCGTTTCACAACGTAAGGTATTCTAGCATTT[T/C]
CCACAATGTAAGCTACTTTCTAAATCTATATAGATTCATTAACATAAATATAAACGTGAAAAATGTTAGAATGATTTACATTGTGAAACTAAGGAAGTAG

Reverse complement sequence

CTACTTCCTTAGTTTCACAATGTAAATCATTCTAACATTTTTCACGTTTATATTTATGTTAATGAATCTATATAGATTTAGAAAGTAGCTTACATTGTGG[A/G]
AAATGCTAGAATACCTTACGTTGTGAAACGGAGGAAGTATAAATGATTAAATTTGATACTCCTACTAATAAGAGAAAGGTATTTAAGGACAACAAAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.90%	31.80%	0.30%	0.00%	NA
All Indica	2759	57.00%	42.60%	0.43%	0.00%	NA
All Japonica	1512	94.90%	5.00%	0.07%	0.00%	NA
Aus	269	23.80%	76.20%	0.00%	0.00%	NA
Indica I	595	48.10%	51.90%	0.00%	0.00%	NA
Indica II	465	39.40%	60.00%	0.65%	0.00%	NA
Indica III	913	65.40%	34.30%	0.33%	0.00%	NA
Indica Intermediate	786	64.50%	34.70%	0.76%	0.00%	NA
Temperate Japonica	767	96.00%	4.00%	0.00%	0.00%	NA
Tropical Japonica	504	92.50%	7.50%	0.00%	0.00%	NA
Japonica Intermediate	241	96.70%	2.90%	0.41%	0.00%	NA
VI/Aromatic	96	76.00%	24.00%	0.00%	0.00%	NA
Intermediate	90	73.30%	25.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0910743892	T -> C	LOC_Os09g17560.1	upstream_gene_variant ; 1981.0bp to feature; MODIFIER	silent_mutation	Average:41.924; most accessible tissue: Zhenshan97 flower, score: 83.172	N	N	N	N
vg0910743892	T -> C	LOC_Os09g17570.1	downstream_gene_variant ; 2111.0bp to feature; MODIFIER	silent_mutation	Average:41.924; most accessible tissue: Zhenshan97 flower, score: 83.172	N	N	N	N
vg0910743892	T -> C	LOC_Os09g17560-LOC_Os09g17570	intergenic_region ; MODIFIER	silent_mutation	Average:41.924; most accessible tissue: Zhenshan97 flower, score: 83.172	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0910743892	NA	8.40E-06	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910743892	NA	9.49E-07	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910743892	NA	9.17E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910743892	NA	6.78E-07	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910743892	4.40E-06	NA	mr1627	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910743892	NA	1.22E-06	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910743892	NA	2.55E-07	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251