\
| Variant ID: vg0910743892 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 10743892 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, C: 0.29, others allele: 0.00, population size: 97. )
TTTTTTTGTTGTCCTTAAATACCTTTCTCTTATTAGTAGGAGTATCAAATTTAATCATTTATACTTCCTCCGTTTCACAACGTAAGGTATTCTAGCATTT[T/C]
CCACAATGTAAGCTACTTTCTAAATCTATATAGATTCATTAACATAAATATAAACGTGAAAAATGTTAGAATGATTTACATTGTGAAACTAAGGAAGTAG
CTACTTCCTTAGTTTCACAATGTAAATCATTCTAACATTTTTCACGTTTATATTTATGTTAATGAATCTATATAGATTTAGAAAGTAGCTTACATTGTGG[A/G]
AAATGCTAGAATACCTTACGTTGTGAAACGGAGGAAGTATAAATGATTAAATTTGATACTCCTACTAATAAGAGAAAGGTATTTAAGGACAACAAAAAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.90% | 31.80% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 57.00% | 42.60% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 94.90% | 5.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 23.80% | 76.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 48.10% | 51.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 39.40% | 60.00% | 0.65% | 0.00% | NA |
| Indica III | 913 | 65.40% | 34.30% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 64.50% | 34.70% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 96.00% | 4.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 92.50% | 7.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 2.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 76.00% | 24.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 25.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0910743892 | T -> C | LOC_Os09g17560.1 | upstream_gene_variant ; 1981.0bp to feature; MODIFIER | silent_mutation | Average:41.924; most accessible tissue: Zhenshan97 flower, score: 83.172 | N | N | N | N |
| vg0910743892 | T -> C | LOC_Os09g17570.1 | downstream_gene_variant ; 2111.0bp to feature; MODIFIER | silent_mutation | Average:41.924; most accessible tissue: Zhenshan97 flower, score: 83.172 | N | N | N | N |
| vg0910743892 | T -> C | LOC_Os09g17560-LOC_Os09g17570 | intergenic_region ; MODIFIER | silent_mutation | Average:41.924; most accessible tissue: Zhenshan97 flower, score: 83.172 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0910743892 | NA | 8.40E-06 | mr1063 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910743892 | NA | 9.49E-07 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910743892 | NA | 9.17E-07 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910743892 | NA | 6.78E-07 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910743892 | 4.40E-06 | NA | mr1627 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910743892 | NA | 1.22E-06 | mr1627 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910743892 | NA | 2.55E-07 | mr1180_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |