\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910743892:

Variant ID: vg0910743892 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10743892
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, C: 0.29, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTTGTTGTCCTTAAATACCTTTCTCTTATTAGTAGGAGTATCAAATTTAATCATTTATACTTCCTCCGTTTCACAACGTAAGGTATTCTAGCATTT[T/C]
CCACAATGTAAGCTACTTTCTAAATCTATATAGATTCATTAACATAAATATAAACGTGAAAAATGTTAGAATGATTTACATTGTGAAACTAAGGAAGTAG

Reverse complement sequence

CTACTTCCTTAGTTTCACAATGTAAATCATTCTAACATTTTTCACGTTTATATTTATGTTAATGAATCTATATAGATTTAGAAAGTAGCTTACATTGTGG[A/G]
AAATGCTAGAATACCTTACGTTGTGAAACGGAGGAAGTATAAATGATTAAATTTGATACTCCTACTAATAAGAGAAAGGTATTTAAGGACAACAAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.90% 31.80% 0.30% 0.00% NA
All Indica  2759 57.00% 42.60% 0.43% 0.00% NA
All Japonica  1512 94.90% 5.00% 0.07% 0.00% NA
Aus  269 23.80% 76.20% 0.00% 0.00% NA
Indica I  595 48.10% 51.90% 0.00% 0.00% NA
Indica II  465 39.40% 60.00% 0.65% 0.00% NA
Indica III  913 65.40% 34.30% 0.33% 0.00% NA
Indica Intermediate  786 64.50% 34.70% 0.76% 0.00% NA
Temperate Japonica  767 96.00% 4.00% 0.00% 0.00% NA
Tropical Japonica  504 92.50% 7.50% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 2.90% 0.41% 0.00% NA
VI/Aromatic  96 76.00% 24.00% 0.00% 0.00% NA
Intermediate  90 73.30% 25.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910743892 T -> C LOC_Os09g17560.1 upstream_gene_variant ; 1981.0bp to feature; MODIFIER silent_mutation Average:41.924; most accessible tissue: Zhenshan97 flower, score: 83.172 N N N N
vg0910743892 T -> C LOC_Os09g17570.1 downstream_gene_variant ; 2111.0bp to feature; MODIFIER silent_mutation Average:41.924; most accessible tissue: Zhenshan97 flower, score: 83.172 N N N N
vg0910743892 T -> C LOC_Os09g17560-LOC_Os09g17570 intergenic_region ; MODIFIER silent_mutation Average:41.924; most accessible tissue: Zhenshan97 flower, score: 83.172 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910743892 NA 8.40E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910743892 NA 9.49E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910743892 NA 9.17E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910743892 NA 6.78E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910743892 4.40E-06 NA mr1627 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910743892 NA 1.22E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910743892 NA 2.55E-07 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251