\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910734911:

Variant ID: vg0910734911 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10734911
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.73, C: 0.27, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


GAGCTTCGGGGCTCCGAGCGATCGTTGATGGTGGCAATGGTGACAACGATGGCAAGTTGCGTGTTGTATGTTTGGATGAGGAAAATGTCGTAAGGGTGTT[C/T]
GCGACATGGCGGGGTCAGCATAGCAACGGCGAGTGGGTGCTTCAGAAGAGTCTCAGGTTAGAGGAGTCCACCATGGGATTGGCTGGGTACAAGGCTGGAC

Reverse complement sequence

GTCCAGCCTTGTACCCAGCCAATCCCATGGTGGACTCCTCTAACCTGAGACTCTTCTGAAGCACCCACTCGCCGTTGCTATGCTGACCCCGCCATGTCGC[G/A]
AACACCCTTACGACATTTTCCTCATCCAAACATACAACACGCAACTTGCCATCGTTGTCACCATTGCCACCATCAACGATCGCTCGGAGCCCCGAAGCTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.90% 22.10% 0.36% 9.61% NA
All Indica  2759 70.40% 18.60% 0.51% 10.44% NA
All Japonica  1512 70.10% 28.50% 0.13% 1.26% NA
Aus  269 26.00% 27.50% 0.37% 46.10% NA
Indica I  595 93.30% 5.00% 0.34% 1.34% NA
Indica II  465 45.20% 41.50% 0.86% 12.47% NA
Indica III  913 66.80% 17.00% 0.66% 15.55% NA
Indica Intermediate  786 72.30% 17.30% 0.25% 10.18% NA
Temperate Japonica  767 50.50% 47.70% 0.00% 1.83% NA
Tropical Japonica  504 91.70% 7.70% 0.40% 0.20% NA
Japonica Intermediate  241 87.60% 10.80% 0.00% 1.66% NA
VI/Aromatic  96 80.20% 3.10% 0.00% 16.67% NA
Intermediate  90 67.80% 24.40% 0.00% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910734911 C -> DEL LOC_Os09g17540.1 N frameshift_variant Average:85.829; most accessible tissue: Zhenshan97 root, score: 93.868 N N N N
vg0910734911 C -> T LOC_Os09g17540.1 synonymous_variant ; p.Phe335Phe; LOW synonymous_codon Average:85.829; most accessible tissue: Zhenshan97 root, score: 93.868 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0910734911 C T 0.02 0.01 0.0 0.02 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910734911 NA 9.36E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734911 NA 3.26E-08 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734911 NA 2.36E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734911 NA 7.40E-07 mr1188 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734911 2.58E-06 2.58E-06 mr1214 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734911 3.31E-06 NA mr1214 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734911 NA 7.59E-06 mr1232 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734911 NA 1.88E-06 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734911 NA 4.95E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734911 NA 6.88E-10 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734911 NA 2.38E-09 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734911 NA 3.93E-08 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734911 NA 1.74E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734911 2.01E-09 NA mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734911 3.97E-06 3.41E-06 mr1627 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734911 NA 4.64E-09 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734911 NA 3.65E-07 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734911 NA 2.90E-11 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734911 NA 9.08E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734911 NA 6.62E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734911 NA 6.78E-07 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734911 NA 4.54E-06 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734911 NA 4.34E-06 mr1466_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734911 NA 9.72E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734911 NA 1.56E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734911 NA 4.55E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910734911 NA 8.63E-07 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251