Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910580422:

Variant ID: vg0910580422 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 10580422
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATCCTGCAGTCTTCCGGAGCTTCGGCAAACAATTGGCGACATCTTCTTCTTCGCAAAGCTGACCATCTAGTACTAGTTGAAATTTGAAGAAGGAAGAAAA[A/G]
AGTAAACCATTTTGCAAATAGCATTAGGGGAAGGAGAAAAAGGAACTTTCGCCAATAGTTTTATTTATAAAATATGTCCTTAGGTTTTATCCACTTGGCT

Reverse complement sequence

AGCCAAGTGGATAAAACCTAAGGACATATTTTATAAATAAAACTATTGGCGAAAGTTCCTTTTTCTCCTTCCCCTAATGCTATTTGCAAAATGGTTTACT[T/C]
TTTTCTTCCTTCTTCAAATTTCAACTAGTACTAGATGGTCAGCTTTGCGAAGAAGAAGATGTCGCCAATTGTTTGCCGAAGCTCCGGAAGACTGCAGGAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.30%	1.10%	2.81%	34.83%	NA
All Indica	2759	52.50%	0.40%	1.16%	45.92%	NA
All Japonica	1512	83.30%	2.30%	3.31%	11.11%	NA
Aus	269	20.40%	0.00%	16.36%	63.20%	NA
Indica I	595	45.50%	0.20%	1.18%	53.11%	NA
Indica II	465	44.90%	0.40%	0.86%	53.76%	NA
Indica III	913	61.10%	0.50%	1.64%	36.69%	NA
Indica Intermediate	786	52.30%	0.40%	0.76%	46.56%	NA
Temperate Japonica	767	76.70%	3.50%	4.43%	15.38%	NA
Tropical Japonica	504	93.80%	0.40%	1.59%	4.17%	NA
Japonica Intermediate	241	82.20%	2.50%	3.32%	12.03%	NA
VI/Aromatic	96	70.80%	2.10%	7.29%	19.79%	NA
Intermediate	90	73.30%	2.20%	0.00%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0910580422	A -> G	LOC_Os09g17260.1	upstream_gene_variant ; 2886.0bp to feature; MODIFIER	silent_mutation	Average:8.547; most accessible tissue: Zhenshan97 flower, score: 15.748	N	N	N	N
vg0910580422	A -> G	LOC_Os09g17240.1	downstream_gene_variant ; 2698.0bp to feature; MODIFIER	silent_mutation	Average:8.547; most accessible tissue: Zhenshan97 flower, score: 15.748	N	N	N	N
vg0910580422	A -> G	LOC_Os09g17270.1	downstream_gene_variant ; 4270.0bp to feature; MODIFIER	silent_mutation	Average:8.547; most accessible tissue: Zhenshan97 flower, score: 15.748	N	N	N	N
vg0910580422	A -> G	LOC_Os09g17250.1	intron_variant ; MODIFIER	silent_mutation	Average:8.547; most accessible tissue: Zhenshan97 flower, score: 15.748	N	N	N	N
vg0910580422	A -> DEL	N	N	silent_mutation	Average:8.547; most accessible tissue: Zhenshan97 flower, score: 15.748	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0910580422	NA	7.48E-10	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0910580422	2.30E-07	NA	mr1900	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251