Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910546070:

Variant ID: vg0910546070 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10546070
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.57, A: 0.44, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TCTCATCGATATCTGCCGCCCGCGTGCAAAGCCCGCAGCAAAGGCAACTCGTACGGGTAAGCCACCCCCGCGTACTTGTTCCTCTCATGGTGGCGCTCCA[C/A]
CGTCATCGTCTCCAGCTCGACGGAGAAGAGCCACGTCTTCTCCACCGACGGCGTCAGGAGCACGTACGCCGCGTCCGCCGCGACGATCATGGCTTCGTTC

Reverse complement sequence

GAACGAAGCCATGATCGTCGCGGCGGACGCGGCGTACGTGCTCCTGACGCCGTCGGTGGAGAAGACGTGGCTCTTCTCCGTCGAGCTGGAGACGATGACG[G/T]
TGGAGCGCCACCATGAGAGGAACAAGTACGCGGGGGTGGCTTACCCGTACGAGTTGCCTTTGCTGCGGGCTTTGCACGCGGGCGGCAGATATCGATGAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.90% 38.40% 0.68% 0.99% NA
All Indica  2759 63.60% 35.20% 0.58% 0.54% NA
All Japonica  1512 61.10% 36.20% 0.73% 1.98% NA
Aus  269 22.30% 77.00% 0.74% 0.00% NA
Indica I  595 38.20% 60.20% 0.84% 0.84% NA
Indica II  465 69.20% 29.90% 0.22% 0.65% NA
Indica III  913 71.40% 27.90% 0.44% 0.22% NA
Indica Intermediate  786 70.60% 28.00% 0.76% 0.64% NA
Temperate Japonica  767 40.70% 57.80% 0.39% 1.17% NA
Tropical Japonica  504 89.10% 5.80% 0.99% 4.17% NA
Japonica Intermediate  241 67.60% 31.10% 1.24% 0.00% NA
VI/Aromatic  96 33.30% 66.70% 0.00% 0.00% NA
Intermediate  90 64.40% 30.00% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910546070 C -> DEL LOC_Os09g17190.1 N frameshift_variant Average:85.291; most accessible tissue: Zhenshan97 root, score: 98.192 N N N N
vg0910546070 C -> A LOC_Os09g17190.1 missense_variant ; p.Val419Leu; MODERATE nonsynonymous_codon ; V419L Average:85.291; most accessible tissue: Zhenshan97 root, score: 98.192 benign 0.476 DELETERIOUS 0.02

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0910546070 C A 0.05 0.03 0.02 -0.02 0.02 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910546070 NA 1.13E-08 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910546070 NA 6.20E-07 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910546070 NA 2.48E-06 mr1048 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910546070 5.42E-06 5.42E-06 mr1048 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910546070 NA 1.04E-09 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910546070 NA 8.25E-06 mr1288 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910546070 3.20E-06 3.19E-06 mr1288 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910546070 NA 3.57E-09 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910546070 NA 2.73E-08 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910546070 NA 8.31E-06 mr1923 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251