\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910545581:

Variant ID: vg0910545581 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10545581
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCAAACGGCTAGCCACTAATTCTTGCCATAGAAAGCAAACCAACCAAACAAAGGGTATATGCATGGCAAGCCCCTGGCAAGCTGGCAACGAGTTGGCTTG[C/G]
CCTTACCCAGCTAGGCTAGGTGGGCAATGGAACCAAACAAACCCTTAAGTTTCTATAGGTGGCTAAGCTAGCTGCCATCAACCGTAGGCCAGCGAAAATA

Reverse complement sequence

TATTTTCGCTGGCCTACGGTTGATGGCAGCTAGCTTAGCCACCTATAGAAACTTAAGGGTTTGTTTGGTTCCATTGCCCACCTAGCCTAGCTGGGTAAGG[G/C]
CAAGCCAACTCGTTGCCAGCTTGCCAGGGGCTTGCCATGCATATACCCTTTGTTTGGTTGGTTTGCTTTCTATGGCAAGAATTAGTGGCTAGCCGTTTGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.50% 10.50% 0.23% 2.75% NA
All Indica  2759 89.40% 10.30% 0.07% 0.18% NA
All Japonica  1512 94.70% 0.30% 0.33% 4.70% NA
Aus  269 26.00% 71.70% 0.74% 1.49% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 83.70% 15.90% 0.43% 0.00% NA
Indica III  913 87.20% 12.80% 0.00% 0.00% NA
Indica Intermediate  786 88.50% 10.80% 0.00% 0.64% NA
Temperate Japonica  767 97.90% 0.10% 0.39% 1.56% NA
Tropical Japonica  504 93.50% 0.00% 0.20% 6.35% NA
Japonica Intermediate  241 87.10% 1.20% 0.41% 11.20% NA
VI/Aromatic  96 40.60% 14.60% 2.08% 42.71% NA
Intermediate  90 87.80% 2.20% 0.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910545581 C -> G LOC_Os09g17180.1 downstream_gene_variant ; 521.0bp to feature; MODIFIER silent_mutation Average:73.736; most accessible tissue: Zhenshan97 root, score: 96.822 N N N N
vg0910545581 C -> G LOC_Os09g17190.1 downstream_gene_variant ; 106.0bp to feature; MODIFIER silent_mutation Average:73.736; most accessible tissue: Zhenshan97 root, score: 96.822 N N N N
vg0910545581 C -> G LOC_Os09g17180-LOC_Os09g17190 intergenic_region ; MODIFIER silent_mutation Average:73.736; most accessible tissue: Zhenshan97 root, score: 96.822 N N N N
vg0910545581 C -> DEL N N silent_mutation Average:73.736; most accessible tissue: Zhenshan97 root, score: 96.822 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0910545581 C G 0.07 0.17 0.08 0.05 0.11 0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910545581 2.99E-06 2.99E-06 mr1098 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545581 6.83E-07 4.80E-07 mr1101 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545581 NA 3.06E-06 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545581 NA 8.13E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545581 NA 6.72E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545581 8.31E-07 2.50E-08 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545581 8.06E-07 1.56E-06 mr1134 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545581 8.44E-07 4.79E-08 mr1150 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545581 1.28E-07 1.28E-07 mr1200 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545581 4.83E-08 1.69E-09 mr1242 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545581 2.52E-07 3.49E-08 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545581 NA 4.50E-06 mr1441 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545581 2.53E-06 2.95E-08 mr1495 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545581 NA 4.57E-07 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545581 7.05E-07 7.05E-07 mr1589 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545581 3.93E-12 3.93E-12 mr1855 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545581 3.01E-06 3.01E-06 mr1868 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545581 1.52E-06 1.04E-07 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545581 7.00E-07 1.76E-08 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545581 NA 8.91E-07 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545581 NA 9.77E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545581 NA 1.86E-07 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545581 NA 1.37E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545581 NA 2.06E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251