Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910545208:

Variant ID: vg0910545208 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 10545208
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:

GTCCAATCGATAATACAAAACTATCCGGCTGCTATGTAATTTCTTTGCTAAGATGCTTGAATATTACTATGTATTCAAGCTAAATAGTTTAAGAATGACA[C/T]
GTGCAGTTTAGATATTATTTAAATAATTGATATGCTTTGGTTTGAACTTGAAATAAAATAGTTCAAAAACATATTTGATTGTTTCAAGGAATTCTTTTAG

Reverse complement sequence

CTAAAAGAATTCCTTGAAACAATCAAATATGTTTTTGAACTATTTTATTTCAAGTTCAAACCAAAGCATATCAATTATTTAAATAATATCTAAACTGCAC[G/A]
TGTCATTCTTAAACTATTTAGCTTGAATACATAGTAATATTCAAGCATCTTAGCAAAGAAATTACATAGCAGCCGGATAGTTTTGTATTATCGATTGGAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.30%	10.90%	0.32%	2.45%	NA
All Indica	2759	88.90%	10.70%	0.18%	0.18%	NA
All Japonica	1512	95.70%	0.30%	0.33%	3.70%	NA
Aus	269	23.80%	74.00%	0.74%	1.49%	NA
Indica I	595	98.50%	1.50%	0.00%	0.00%	NA
Indica II	465	83.70%	16.30%	0.00%	0.00%	NA
Indica III	913	86.10%	13.60%	0.33%	0.00%	NA
Indica Intermediate	786	88.20%	10.90%	0.25%	0.64%	NA
Temperate Japonica	767	98.00%	0.10%	0.26%	1.56%	NA
Tropical Japonica	504	96.40%	0.00%	0.40%	3.17%	NA
Japonica Intermediate	241	86.70%	1.20%	0.41%	11.62%	NA
VI/Aromatic	96	38.50%	15.60%	2.08%	43.75%	NA
Intermediate	90	86.70%	2.20%	1.11%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0910545208	C -> DEL	N	N	silent_mutation	Average:41.394; most accessible tissue: Zhenshan97 root, score: 78.911	N	N	N	N
vg0910545208	C -> T	LOC_Os09g17180.1	downstream_gene_variant ; 148.0bp to feature; MODIFIER	silent_mutation	Average:41.394; most accessible tissue: Zhenshan97 root, score: 78.911	N	N	N	N
vg0910545208	C -> T	LOC_Os09g17190.1	downstream_gene_variant ; 479.0bp to feature; MODIFIER	silent_mutation	Average:41.394; most accessible tissue: Zhenshan97 root, score: 78.911	N	N	N	N
vg0910545208	C -> T	LOC_Os09g17180-LOC_Os09g17190	intergenic_region ; MODIFIER	silent_mutation	Average:41.394; most accessible tissue: Zhenshan97 root, score: 78.911	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0910545208	NA	6.55E-06	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545208	NA	2.14E-14	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545208	5.85E-07	2.97E-08	mr1232	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545208	NA	2.54E-06	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545208	8.42E-06	8.42E-06	mr1566	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545208	NA	9.97E-06	mr1609	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545208	4.12E-06	1.16E-06	mr1895	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545208	NA	3.80E-09	mr1166_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910545208	NA	4.06E-14	mr1846_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251