\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910525504:

Variant ID: vg0910525504 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10525504
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTACAGCAATTTTTGGTACATACATAATGAAACATCATGAGTACACTAGCTGAAACATTGTTGGTGGAAAAAAAATAAAACGGATTCTCCTAATAGGGC[G/A]
TTTCCGTAATATGCAGGTGATTTGCTGCAAAGCGTGCGTGGTGGGGGTGGCGCGTGAGGCGTGGGAGCCGCGGGAGTCCGATTTTTTCTCCCCACCCCCC

Reverse complement sequence

GGGGGGTGGGGAGAAAAAATCGGACTCCCGCGGCTCCCACGCCTCACGCGCCACCCCCACCACGCACGCTTTGCAGCAAATCACCTGCATATTACGGAAA[C/T]
GCCCTATTAGGAGAATCCGTTTTATTTTTTTTCCACCAACAATGTTTCAGCTAGTGTACTCATGATGTTTCATTATGTATGTACCAAAAATTGCTGTAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.30% 9.90% 0.13% 3.66% NA
All Indica  2759 98.20% 1.60% 0.00% 0.18% NA
All Japonica  1512 65.80% 26.50% 0.20% 7.47% NA
Aus  269 93.30% 5.20% 0.37% 1.12% NA
Indica I  595 94.30% 5.70% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.50% 0.90% 0.00% 0.64% NA
Temperate Japonica  767 77.10% 16.80% 0.13% 6.00% NA
Tropical Japonica  504 57.30% 35.70% 0.40% 6.55% NA
Japonica Intermediate  241 47.70% 38.20% 0.00% 14.11% NA
VI/Aromatic  96 51.00% 2.10% 1.04% 45.83% NA
Intermediate  90 81.10% 8.90% 1.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910525504 G -> DEL N N silent_mutation Average:48.173; most accessible tissue: Callus, score: 75.473 N N N N
vg0910525504 G -> A LOC_Os09g17146.1 upstream_gene_variant ; 3786.0bp to feature; MODIFIER silent_mutation Average:48.173; most accessible tissue: Callus, score: 75.473 N N N N
vg0910525504 G -> A LOC_Os09g17152.1 upstream_gene_variant ; 967.0bp to feature; MODIFIER silent_mutation Average:48.173; most accessible tissue: Callus, score: 75.473 N N N N
vg0910525504 G -> A LOC_Os09g17160.1 downstream_gene_variant ; 3563.0bp to feature; MODIFIER silent_mutation Average:48.173; most accessible tissue: Callus, score: 75.473 N N N N
vg0910525504 G -> A LOC_Os09g17152-LOC_Os09g17160 intergenic_region ; MODIFIER silent_mutation Average:48.173; most accessible tissue: Callus, score: 75.473 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910525504 NA 3.06E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910525504 NA 2.97E-08 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910525504 NA 4.69E-09 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910525504 NA 6.60E-08 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910525504 NA 1.74E-09 mr1794 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910525504 NA 3.14E-09 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910525504 NA 1.87E-08 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910525504 NA 1.62E-06 mr1531_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910525504 NA 4.08E-09 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251