\
| Variant ID: vg0910525504 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 10525504 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCTACAGCAATTTTTGGTACATACATAATGAAACATCATGAGTACACTAGCTGAAACATTGTTGGTGGAAAAAAAATAAAACGGATTCTCCTAATAGGGC[G/A]
TTTCCGTAATATGCAGGTGATTTGCTGCAAAGCGTGCGTGGTGGGGGTGGCGCGTGAGGCGTGGGAGCCGCGGGAGTCCGATTTTTTCTCCCCACCCCCC
GGGGGGTGGGGAGAAAAAATCGGACTCCCGCGGCTCCCACGCCTCACGCGCCACCCCCACCACGCACGCTTTGCAGCAAATCACCTGCATATTACGGAAA[C/T]
GCCCTATTAGGAGAATCCGTTTTATTTTTTTTCCACCAACAATGTTTCAGCTAGTGTACTCATGATGTTTCATTATGTATGTACCAAAAATTGCTGTAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.30% | 9.90% | 0.13% | 3.66% | NA |
| All Indica | 2759 | 98.20% | 1.60% | 0.00% | 0.18% | NA |
| All Japonica | 1512 | 65.80% | 26.50% | 0.20% | 7.47% | NA |
| Aus | 269 | 93.30% | 5.20% | 0.37% | 1.12% | NA |
| Indica I | 595 | 94.30% | 5.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.50% | 0.90% | 0.00% | 0.64% | NA |
| Temperate Japonica | 767 | 77.10% | 16.80% | 0.13% | 6.00% | NA |
| Tropical Japonica | 504 | 57.30% | 35.70% | 0.40% | 6.55% | NA |
| Japonica Intermediate | 241 | 47.70% | 38.20% | 0.00% | 14.11% | NA |
| VI/Aromatic | 96 | 51.00% | 2.10% | 1.04% | 45.83% | NA |
| Intermediate | 90 | 81.10% | 8.90% | 1.11% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0910525504 | G -> DEL | N | N | silent_mutation | Average:48.173; most accessible tissue: Callus, score: 75.473 | N | N | N | N |
| vg0910525504 | G -> A | LOC_Os09g17146.1 | upstream_gene_variant ; 3786.0bp to feature; MODIFIER | silent_mutation | Average:48.173; most accessible tissue: Callus, score: 75.473 | N | N | N | N |
| vg0910525504 | G -> A | LOC_Os09g17152.1 | upstream_gene_variant ; 967.0bp to feature; MODIFIER | silent_mutation | Average:48.173; most accessible tissue: Callus, score: 75.473 | N | N | N | N |
| vg0910525504 | G -> A | LOC_Os09g17160.1 | downstream_gene_variant ; 3563.0bp to feature; MODIFIER | silent_mutation | Average:48.173; most accessible tissue: Callus, score: 75.473 | N | N | N | N |
| vg0910525504 | G -> A | LOC_Os09g17152-LOC_Os09g17160 | intergenic_region ; MODIFIER | silent_mutation | Average:48.173; most accessible tissue: Callus, score: 75.473 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0910525504 | NA | 3.06E-06 | mr1063 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910525504 | NA | 2.97E-08 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910525504 | NA | 4.69E-09 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910525504 | NA | 6.60E-08 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910525504 | NA | 1.74E-09 | mr1794 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910525504 | NA | 3.14E-09 | mr1180_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910525504 | NA | 1.87E-08 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910525504 | NA | 1.62E-06 | mr1531_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910525504 | NA | 4.08E-09 | mr1794_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |