Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910525504:

Variant ID: vg0910525504 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 10525504
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTACAGCAATTTTTGGTACATACATAATGAAACATCATGAGTACACTAGCTGAAACATTGTTGGTGGAAAAAAAATAAAACGGATTCTCCTAATAGGGC[G/A]
TTTCCGTAATATGCAGGTGATTTGCTGCAAAGCGTGCGTGGTGGGGGTGGCGCGTGAGGCGTGGGAGCCGCGGGAGTCCGATTTTTTCTCCCCACCCCCC

Reverse complement sequence

GGGGGGTGGGGAGAAAAAATCGGACTCCCGCGGCTCCCACGCCTCACGCGCCACCCCCACCACGCACGCTTTGCAGCAAATCACCTGCATATTACGGAAA[C/T]
GCCCTATTAGGAGAATCCGTTTTATTTTTTTTCCACCAACAATGTTTCAGCTAGTGTACTCATGATGTTTCATTATGTATGTACCAAAAATTGCTGTAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.30%	9.90%	0.13%	3.66%	NA
All Indica	2759	98.20%	1.60%	0.00%	0.18%	NA
All Japonica	1512	65.80%	26.50%	0.20%	7.47%	NA
Aus	269	93.30%	5.20%	0.37%	1.12%	NA
Indica I	595	94.30%	5.70%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.50%	0.90%	0.00%	0.64%	NA
Temperate Japonica	767	77.10%	16.80%	0.13%	6.00%	NA
Tropical Japonica	504	57.30%	35.70%	0.40%	6.55%	NA
Japonica Intermediate	241	47.70%	38.20%	0.00%	14.11%	NA
VI/Aromatic	96	51.00%	2.10%	1.04%	45.83%	NA
Intermediate	90	81.10%	8.90%	1.11%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0910525504	G -> DEL	N	N	silent_mutation	Average:48.173; most accessible tissue: Callus, score: 75.473	N	N	N	N
vg0910525504	G -> A	LOC_Os09g17146.1	upstream_gene_variant ; 3786.0bp to feature; MODIFIER	silent_mutation	Average:48.173; most accessible tissue: Callus, score: 75.473	N	N	N	N
vg0910525504	G -> A	LOC_Os09g17152.1	upstream_gene_variant ; 967.0bp to feature; MODIFIER	silent_mutation	Average:48.173; most accessible tissue: Callus, score: 75.473	N	N	N	N
vg0910525504	G -> A	LOC_Os09g17160.1	downstream_gene_variant ; 3563.0bp to feature; MODIFIER	silent_mutation	Average:48.173; most accessible tissue: Callus, score: 75.473	N	N	N	N
vg0910525504	G -> A	LOC_Os09g17152-LOC_Os09g17160	intergenic_region ; MODIFIER	silent_mutation	Average:48.173; most accessible tissue: Callus, score: 75.473	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0910525504	NA	3.06E-06	mr1063	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910525504	NA	2.97E-08	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910525504	NA	4.69E-09	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910525504	NA	6.60E-08	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910525504	NA	1.74E-09	mr1794	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910525504	NA	3.14E-09	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910525504	NA	1.87E-08	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910525504	NA	1.62E-06	mr1531_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910525504	NA	4.08E-09	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251