Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0910517345:

Variant ID: vg0910517345 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10517345
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


AAGGAAGAACATATCAGTTAACTAGGCTATTTCAAACAACAATTGGGTAGGTGACCTCCTGTCTATGCACTATGCCACGGCCCAGCATTTTCAACAATTT[G/A]
TCAAGCTCCGGATGCAAATCCAAACAATCGACCTGCTGCCAAACACCGAAGACTGCATCAAGTGGAGGTTCACTGAGCACGGCCAATACTCGTCCAAATC

Reverse complement sequence

GATTTGGACGAGTATTGGCCGTGCTCAGTGAACCTCCACTTGATGCAGTCTTCGGTGTTTGGCAGCAGGTCGATTGTTTGGATTTGCATCCGGAGCTTGA[C/T]
AAATTGTTGAAAATGCTGGGCCGTGGCATAGTGCATAGACAGGAGGTCACCTACCCAATTGTTGTTTGAAATAGCCTAGTTAACTGATATGTTCTTCCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.80% 6.70% 0.04% 0.42% NA
All Indica  2759 97.00% 2.90% 0.04% 0.00% NA
All Japonica  1512 98.50% 0.20% 0.00% 1.32% NA
Aus  269 25.70% 74.30% 0.00% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 94.20% 5.80% 0.00% 0.00% NA
Indica III  913 98.70% 1.30% 0.00% 0.00% NA
Indica Intermediate  786 95.80% 4.10% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 96.00% 0.00% 0.00% 3.97% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 68.80% 30.20% 1.04% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910517345 G -> DEL N N silent_mutation Average:50.132; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg0910517345 G -> A LOC_Os09g17146.1 downstream_gene_variant ; 2594.0bp to feature; MODIFIER silent_mutation Average:50.132; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg0910517345 G -> A LOC_Os09g17140-LOC_Os09g17146 intergenic_region ; MODIFIER silent_mutation Average:50.132; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910517345 3.77E-07 NA mr1004 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910517345 8.14E-06 NA mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910517345 NA 9.11E-20 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251