\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910516438:

Variant ID: vg0910516438 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10516438
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCGCGGACGCAGCGGCGGCGGCACGGACACGGAGGCGGTGGCGTGGACGGCGACTGTGGTGGTGCGGAGCCTGTGGTCGGGGCGCATTTTTTTGTTCGTC[C/T]
AGAGGATTTTCGCAGGCGGGCCATTGGGTGATGATTTTCGCAGGCGTTTATCTACAGGCGGTCCTTCCCCCGCCTAGAAAAACTACTTTTGGCCGCCTGC

Reverse complement sequence

GCAGGCGGCCAAAAGTAGTTTTTCTAGGCGGGGGAAGGACCGCCTGTAGATAAACGCCTGCGAAAATCATCACCCAATGGCCCGCCTGCGAAAATCCTCT[G/A]
GACGAACAAAAAAATGCGCCCCGACCACAGGCTCCGCACCACCACAGTCGCCGTCCACGCCACCGCCTCCGTGTCCGTGCCGCCGCCGCTGCGTCCGCGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.20% 9.30% 0.02% 0.44% NA
All Indica  2759 87.50% 12.40% 0.04% 0.00% NA
All Japonica  1512 93.30% 5.40% 0.00% 1.39% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.20% 1.80% 0.00% 0.00% NA
Indica II  465 68.00% 32.00% 0.00% 0.00% NA
Indica III  913 91.60% 8.30% 0.11% 0.00% NA
Indica Intermediate  786 86.40% 13.60% 0.00% 0.00% NA
Temperate Japonica  767 95.70% 4.30% 0.00% 0.00% NA
Tropical Japonica  504 89.30% 6.50% 0.00% 4.17% NA
Japonica Intermediate  241 93.80% 6.20% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910516438 C -> DEL N N silent_mutation Average:63.268; most accessible tissue: Zhenshan97 young leaf, score: 84.035 N N N N
vg0910516438 C -> T LOC_Os09g17146.1 downstream_gene_variant ; 3501.0bp to feature; MODIFIER silent_mutation Average:63.268; most accessible tissue: Zhenshan97 young leaf, score: 84.035 N N N N
vg0910516438 C -> T LOC_Os09g17140-LOC_Os09g17146 intergenic_region ; MODIFIER silent_mutation Average:63.268; most accessible tissue: Zhenshan97 young leaf, score: 84.035 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0910516438 C T 0.01 0.0 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910516438 NA 2.86E-07 mr1157 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910516438 NA 4.55E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910516438 NA 7.42E-06 mr1328 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910516438 NA 8.25E-08 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910516438 NA 1.14E-10 mr1425 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910516438 NA 2.86E-07 mr1446 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910516438 NA 2.37E-06 mr1817 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910516438 NA 7.86E-07 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910516438 NA 1.04E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251