\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910486271:

Variant ID: vg0910486271 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10486271
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


GTGGCGCTTGCCCCTCGATGGAGTGTGGCAGAGGCTCGCTCTCGTGCGGATCTGGCGGAGCGCGGTGGACGCCCGAGCTTGCGCGGATCCGACGGCGTGA[C/T]
GTTGGAGGACGTACGTGGCGACGATCGTCAGTGTGAAGATGGGGCCACCTAATCTGTATGCCTAGAGGTCAAGGGCCACTGGATCTAGCCGCTTCGAGCC

Reverse complement sequence

GGCTCGAAGCGGCTAGATCCAGTGGCCCTTGACCTCTAGGCATACAGATTAGGTGGCCCCATCTTCACACTGACGATCGTCGCCACGTACGTCCTCCAAC[G/A]
TCACGCCGTCGGATCCGCGCAAGCTCGGGCGTCCACCGCGCTCCGCCAGATCCGCACGAGAGCGAGCCTCTGCCACACTCCATCGAGGGGCAAGCGCCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.20% 22.20% 0.19% 0.40% NA
All Indica  2759 79.10% 20.70% 0.25% 0.00% NA
All Japonica  1512 81.70% 17.00% 0.07% 1.26% NA
Aus  269 29.40% 70.30% 0.37% 0.00% NA
Indica I  595 98.00% 2.00% 0.00% 0.00% NA
Indica II  465 51.00% 49.00% 0.00% 0.00% NA
Indica III  913 83.90% 15.60% 0.55% 0.00% NA
Indica Intermediate  786 75.80% 23.90% 0.25% 0.00% NA
Temperate Japonica  767 95.00% 5.00% 0.00% 0.00% NA
Tropical Japonica  504 62.90% 33.10% 0.20% 3.77% NA
Japonica Intermediate  241 78.40% 21.60% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910486271 C -> DEL N N silent_mutation Average:71.312; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0910486271 C -> T LOC_Os09g17110.1 downstream_gene_variant ; 4013.0bp to feature; MODIFIER silent_mutation Average:71.312; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0910486271 C -> T LOC_Os09g17120.1 downstream_gene_variant ; 1585.0bp to feature; MODIFIER silent_mutation Average:71.312; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0910486271 C -> T LOC_Os09g17110-LOC_Os09g17120 intergenic_region ; MODIFIER silent_mutation Average:71.312; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910486271 NA 7.40E-07 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910486271 NA 3.27E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910486271 NA 8.82E-07 mr1188 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910486271 3.35E-06 NA mr1214 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910486271 NA 3.11E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910486271 NA 1.37E-11 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910486271 NA 1.92E-11 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910486271 NA 3.26E-09 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910486271 NA 5.58E-07 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910486271 NA 9.28E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910486271 NA 5.44E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910486271 NA 5.64E-09 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910486271 NA 2.14E-10 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910486271 NA 4.48E-06 mr1717_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910486271 NA 4.00E-06 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910486271 NA 1.07E-08 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910486271 NA 4.97E-06 mr1946_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910486271 NA 4.97E-06 mr1948_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251