Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910454613:

Variant ID: vg0910454613 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 10454613
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACATAGATGGCAGCTTCATCCCCGTGTAGCTGCCCTACCCTTGCTCCGCTGCCGAACATGACATCGTCGACTTCACCTGCCCCTTCCTCCCGTTGTCCC[C/T]
GGATCTCTGGCGCCATGATGATATCCTCGACAGCTACGTCCTCTTCTCCCGCGACGCTGATGGCCCCCGCGAAGACCGGAGGAGAACACCGAGTCGGTGG

Reverse complement sequence

CCACCGACTCGGTGTTCTCCTCCGGTCTTCGCGGGGGCCATCAGCGTCGCGGGAGAAGAGGACGTAGCTGTCGAGGATATCATCATGGCGCCAGAGATCC[G/A]
GGGACAACGGGAGGAAGGGGCAGGTGAAGTCGACGATGTCATGTTCGGCAGCGGAGCAAGGGTAGGGCAGCTACACGGGGATGAAGCTGCCATCTATGTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	25.40%	19.70%	0.80%	54.02%	NA
All Indica	2759	9.00%	0.90%	1.27%	88.84%	NA
All Japonica	1512	41.20%	56.30%	0.00%	2.45%	NA
Aus	269	79.90%	6.30%	0.00%	13.75%	NA
Indica I	595	15.00%	1.30%	1.68%	82.02%	NA
Indica II	465	10.30%	0.90%	1.72%	87.10%	NA
Indica III	913	3.50%	0.30%	0.99%	95.18%	NA
Indica Intermediate	786	9.90%	1.40%	1.02%	87.66%	NA
Temperate Japonica	767	63.20%	35.30%	0.00%	1.43%	NA
Tropical Japonica	504	9.70%	87.70%	0.00%	2.58%	NA
Japonica Intermediate	241	36.90%	57.70%	0.00%	5.39%	NA
VI/Aromatic	96	82.30%	11.50%	0.00%	6.25%	NA
Intermediate	90	42.20%	30.00%	3.33%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0910454613	C -> DEL	LOC_Os09g17060.1	N	frameshift_variant	Average:10.385; most accessible tissue: Callus, score: 54.312	N	N	N	N
vg0910454613	C -> T	LOC_Os09g17060.1	missense_variant ; p.Arg6Gln; MODERATE	nonsynonymous_codon ; R6Q	Average:10.385; most accessible tissue: Callus, score: 54.312	unknown	unknown	DELETERIOUS	0.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0910454613	3.82E-06	1.90E-16	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613	NA	2.07E-12	mr1205	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613	NA	1.93E-08	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613	NA	3.11E-07	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613	1.72E-06	NA	mr1316	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613	NA	4.90E-13	mr1330	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613	NA	2.86E-09	mr1332	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613	NA	1.15E-09	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613	NA	6.22E-07	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613	NA	1.61E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613	NA	8.49E-09	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613	NA	3.23E-07	mr1507	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613	2.13E-06	NA	mr1544	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613	NA	2.75E-13	mr1579	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613	NA	5.36E-08	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613	NA	2.57E-23	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613	NA	1.02E-11	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613	NA	1.54E-06	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613	NA	2.33E-08	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613	NA	2.34E-08	mr1680	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613	NA	6.03E-11	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613	NA	1.95E-09	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613	NA	2.87E-08	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613	NA	6.07E-07	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613	NA	1.77E-06	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613	4.68E-06	NA	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613	NA	6.64E-06	mr1977	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251