\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910454613:

Variant ID: vg0910454613 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10454613
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACATAGATGGCAGCTTCATCCCCGTGTAGCTGCCCTACCCTTGCTCCGCTGCCGAACATGACATCGTCGACTTCACCTGCCCCTTCCTCCCGTTGTCCC[C/T]
GGATCTCTGGCGCCATGATGATATCCTCGACAGCTACGTCCTCTTCTCCCGCGACGCTGATGGCCCCCGCGAAGACCGGAGGAGAACACCGAGTCGGTGG

Reverse complement sequence

CCACCGACTCGGTGTTCTCCTCCGGTCTTCGCGGGGGCCATCAGCGTCGCGGGAGAAGAGGACGTAGCTGTCGAGGATATCATCATGGCGCCAGAGATCC[G/A]
GGGACAACGGGAGGAAGGGGCAGGTGAAGTCGACGATGTCATGTTCGGCAGCGGAGCAAGGGTAGGGCAGCTACACGGGGATGAAGCTGCCATCTATGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.40% 19.70% 0.80% 54.02% NA
All Indica  2759 9.00% 0.90% 1.27% 88.84% NA
All Japonica  1512 41.20% 56.30% 0.00% 2.45% NA
Aus  269 79.90% 6.30% 0.00% 13.75% NA
Indica I  595 15.00% 1.30% 1.68% 82.02% NA
Indica II  465 10.30% 0.90% 1.72% 87.10% NA
Indica III  913 3.50% 0.30% 0.99% 95.18% NA
Indica Intermediate  786 9.90% 1.40% 1.02% 87.66% NA
Temperate Japonica  767 63.20% 35.30% 0.00% 1.43% NA
Tropical Japonica  504 9.70% 87.70% 0.00% 2.58% NA
Japonica Intermediate  241 36.90% 57.70% 0.00% 5.39% NA
VI/Aromatic  96 82.30% 11.50% 0.00% 6.25% NA
Intermediate  90 42.20% 30.00% 3.33% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910454613 C -> DEL LOC_Os09g17060.1 N frameshift_variant Average:10.385; most accessible tissue: Callus, score: 54.312 N N N N
vg0910454613 C -> T LOC_Os09g17060.1 missense_variant ; p.Arg6Gln; MODERATE nonsynonymous_codon ; R6Q Average:10.385; most accessible tissue: Callus, score: 54.312 unknown unknown DELETERIOUS 0.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910454613 3.82E-06 1.90E-16 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613 NA 2.07E-12 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613 NA 1.93E-08 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613 NA 3.11E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613 1.72E-06 NA mr1316 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613 NA 4.90E-13 mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613 NA 2.86E-09 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613 NA 1.15E-09 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613 NA 6.22E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613 NA 1.61E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613 NA 8.49E-09 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613 NA 3.23E-07 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613 2.13E-06 NA mr1544 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613 NA 2.75E-13 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613 NA 5.36E-08 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613 NA 2.57E-23 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613 NA 1.02E-11 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613 NA 1.54E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613 NA 2.33E-08 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613 NA 2.34E-08 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613 NA 6.03E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613 NA 1.95E-09 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613 NA 2.87E-08 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613 NA 6.07E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613 NA 1.77E-06 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613 4.68E-06 NA mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454613 NA 6.64E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251