\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910454036:

Variant ID: vg0910454036 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10454036
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACGATTTTTTTTATATGTTTATCTATTTTTATACTTTTATCAATTATCCAAAGGTTATAAATGACTAGTTGTATGGTGTGCCTTTTGGGGGAAGGGATG[C/T]
AATTTATACCCTGAATGAATCATCCAACGGCTAAAAACAGTTGAGGTCATGTCAAGAGATGCAATTTACATACTTGATGAATCATCCAAATACTAAAAAC

Reverse complement sequence

GTTTTTAGTATTTGGATGATTCATCAAGTATGTAAATTGCATCTCTTGACATGACCTCAACTGTTTTTAGCCGTTGGATGATTCATTCAGGGTATAAATT[G/A]
CATCCCTTCCCCCAAAAGGCACACCATACAACTAGTCATTTATAACCTTTGGATAATTGATAAAAGTATAAAAATAGATAAACATATAAAAAAAATCGTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.40% 20.70% 0.91% 53.98% NA
All Indica  2759 8.80% 1.00% 1.41% 88.80% NA
All Japonica  1512 38.40% 59.30% 0.00% 2.38% NA
Aus  269 79.90% 6.30% 0.37% 13.38% NA
Indica I  595 14.80% 1.20% 2.35% 81.68% NA
Indica II  465 10.30% 1.10% 1.94% 86.67% NA
Indica III  913 3.60% 0.40% 0.66% 95.29% NA
Indica Intermediate  786 9.40% 1.40% 1.27% 87.91% NA
Temperate Japonica  767 60.80% 37.90% 0.00% 1.30% NA
Tropical Japonica  504 8.90% 88.50% 0.00% 2.58% NA
Japonica Intermediate  241 28.60% 66.00% 0.00% 5.39% NA
VI/Aromatic  96 82.30% 11.50% 0.00% 6.25% NA
Intermediate  90 40.00% 31.10% 3.33% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910454036 C -> DEL N N silent_mutation Average:13.594; most accessible tissue: Callus, score: 86.277 N N N N
vg0910454036 C -> T LOC_Os09g17049.1 downstream_gene_variant ; 1268.0bp to feature; MODIFIER silent_mutation Average:13.594; most accessible tissue: Callus, score: 86.277 N N N N
vg0910454036 C -> T LOC_Os09g17060.1 downstream_gene_variant ; 330.0bp to feature; MODIFIER silent_mutation Average:13.594; most accessible tissue: Callus, score: 86.277 N N N N
vg0910454036 C -> T LOC_Os09g17049.2 downstream_gene_variant ; 1268.0bp to feature; MODIFIER silent_mutation Average:13.594; most accessible tissue: Callus, score: 86.277 N N N N
vg0910454036 C -> T LOC_Os09g17049-LOC_Os09g17060 intergenic_region ; MODIFIER silent_mutation Average:13.594; most accessible tissue: Callus, score: 86.277 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910454036 2.64E-06 2.41E-17 mr1164 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036 NA 1.61E-13 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036 NA 2.02E-09 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036 NA 4.08E-08 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036 NA 4.69E-13 mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036 NA 1.72E-09 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036 NA 5.19E-10 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036 NA 1.11E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036 NA 3.50E-07 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036 NA 9.57E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036 NA 2.62E-09 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036 8.11E-06 2.18E-07 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036 4.67E-06 NA mr1544 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036 NA 4.02E-13 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036 NA 9.18E-09 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036 NA 2.94E-24 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036 NA 6.13E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036 NA 3.36E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036 NA 8.67E-09 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036 NA 1.00E-08 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036 NA 6.15E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036 NA 2.49E-13 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036 NA 3.16E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036 NA 1.47E-09 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036 NA 7.63E-06 mr1809 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036 NA 7.50E-09 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036 NA 2.29E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036 NA 2.43E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036 NA 2.29E-06 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251