Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910454036:

Variant ID: vg0910454036 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 10454036
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TACGATTTTTTTTATATGTTTATCTATTTTTATACTTTTATCAATTATCCAAAGGTTATAAATGACTAGTTGTATGGTGTGCCTTTTGGGGGAAGGGATG[C/T]
AATTTATACCCTGAATGAATCATCCAACGGCTAAAAACAGTTGAGGTCATGTCAAGAGATGCAATTTACATACTTGATGAATCATCCAAATACTAAAAAC

Reverse complement sequence

GTTTTTAGTATTTGGATGATTCATCAAGTATGTAAATTGCATCTCTTGACATGACCTCAACTGTTTTTAGCCGTTGGATGATTCATTCAGGGTATAAATT[G/A]
CATCCCTTCCCCCAAAAGGCACACCATACAACTAGTCATTTATAACCTTTGGATAATTGATAAAAGTATAAAAATAGATAAACATATAAAAAAAATCGTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	24.40%	20.70%	0.91%	53.98%	NA
All Indica	2759	8.80%	1.00%	1.41%	88.80%	NA
All Japonica	1512	38.40%	59.30%	0.00%	2.38%	NA
Aus	269	79.90%	6.30%	0.37%	13.38%	NA
Indica I	595	14.80%	1.20%	2.35%	81.68%	NA
Indica II	465	10.30%	1.10%	1.94%	86.67%	NA
Indica III	913	3.60%	0.40%	0.66%	95.29%	NA
Indica Intermediate	786	9.40%	1.40%	1.27%	87.91%	NA
Temperate Japonica	767	60.80%	37.90%	0.00%	1.30%	NA
Tropical Japonica	504	8.90%	88.50%	0.00%	2.58%	NA
Japonica Intermediate	241	28.60%	66.00%	0.00%	5.39%	NA
VI/Aromatic	96	82.30%	11.50%	0.00%	6.25%	NA
Intermediate	90	40.00%	31.10%	3.33%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0910454036	C -> DEL	N	N	silent_mutation	Average:13.594; most accessible tissue: Callus, score: 86.277	N	N	N	N
vg0910454036	C -> T	LOC_Os09g17049.1	downstream_gene_variant ; 1268.0bp to feature; MODIFIER	silent_mutation	Average:13.594; most accessible tissue: Callus, score: 86.277	N	N	N	N
vg0910454036	C -> T	LOC_Os09g17060.1	downstream_gene_variant ; 330.0bp to feature; MODIFIER	silent_mutation	Average:13.594; most accessible tissue: Callus, score: 86.277	N	N	N	N
vg0910454036	C -> T	LOC_Os09g17049.2	downstream_gene_variant ; 1268.0bp to feature; MODIFIER	silent_mutation	Average:13.594; most accessible tissue: Callus, score: 86.277	N	N	N	N
vg0910454036	C -> T	LOC_Os09g17049-LOC_Os09g17060	intergenic_region ; MODIFIER	silent_mutation	Average:13.594; most accessible tissue: Callus, score: 86.277	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0910454036	2.64E-06	2.41E-17	mr1164	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036	NA	1.61E-13	mr1205	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036	NA	2.02E-09	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036	NA	4.08E-08	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036	NA	4.69E-13	mr1330	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036	NA	1.72E-09	mr1332	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036	NA	5.19E-10	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036	NA	1.11E-07	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036	NA	3.50E-07	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036	NA	9.57E-07	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036	NA	2.62E-09	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036	8.11E-06	2.18E-07	mr1507	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036	4.67E-06	NA	mr1544	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036	NA	4.02E-13	mr1579	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036	NA	9.18E-09	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036	NA	2.94E-24	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036	NA	6.13E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036	NA	3.36E-06	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036	NA	8.67E-09	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036	NA	1.00E-08	mr1680	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036	NA	6.15E-11	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036	NA	2.49E-13	mr1701	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036	NA	3.16E-11	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036	NA	1.47E-09	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036	NA	7.63E-06	mr1809	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036	NA	7.50E-09	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036	NA	2.29E-07	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036	NA	2.43E-07	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910454036	NA	2.29E-06	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251