Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910453386:

Variant ID: vg0910453386 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 10453386
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTTGGGGAGAATACCCCCGTGGGCTCCAATTTCTCTGAGGGTTATTTTGGTAAAATTGGAGGTGGAAATTTCCTAGGGGAAATCCACGTAGAAAATGAT[C/T]
CCAGATGCGTTTGGAAAACGAGGATTGCAGCGCATAATGTTTGTTCCAGCGACCAATTCGTTGTCGTGCGCTCGTGTGTCCACATAATTTCCCGACGTTG

Reverse complement sequence

CAACGTCGGGAAATTATGTGGACACACGAGCGCACGACAACGAATTGGTCGCTGGAACAAACATTATGCGCTGCAATCCTCGTTTTCCAAACGCATCTGG[G/A]
ATCATTTTCTACGTGGATTTCCCCTAGGAAATTTCCACCTCCAATTTTACCAAAATAACCCTCAGAGAAATTGGAGCCCACGGGGGTATTCTCCCCAAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	25.50%	19.70%	0.70%	54.17%	NA
All Indica	2759	8.90%	0.90%	1.12%	89.09%	NA
All Japonica	1512	41.30%	56.20%	0.07%	2.45%	NA
Aus	269	80.30%	6.30%	0.00%	13.38%	NA
Indica I	595	15.00%	1.20%	1.01%	82.86%	NA
Indica II	465	10.30%	0.60%	1.72%	87.31%	NA
Indica III	913	3.70%	0.30%	0.88%	95.07%	NA
Indica Intermediate	786	9.40%	1.50%	1.15%	87.91%	NA
Temperate Japonica	767	63.50%	34.90%	0.13%	1.43%	NA
Tropical Japonica	504	9.70%	87.70%	0.00%	2.58%	NA
Japonica Intermediate	241	36.90%	57.70%	0.00%	5.39%	NA
VI/Aromatic	96	82.30%	11.50%	0.00%	6.25%	NA
Intermediate	90	43.30%	30.00%	1.11%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0910453386	C -> DEL	N	N	silent_mutation	Average:15.514; most accessible tissue: Callus, score: 92.414	N	N	N	N
vg0910453386	C -> T	LOC_Os09g17040.1	upstream_gene_variant ; 4953.0bp to feature; MODIFIER	silent_mutation	Average:15.514; most accessible tissue: Callus, score: 92.414	N	N	N	N
vg0910453386	C -> T	LOC_Os09g17049.1	downstream_gene_variant ; 618.0bp to feature; MODIFIER	silent_mutation	Average:15.514; most accessible tissue: Callus, score: 92.414	N	N	N	N
vg0910453386	C -> T	LOC_Os09g17060.1	downstream_gene_variant ; 980.0bp to feature; MODIFIER	silent_mutation	Average:15.514; most accessible tissue: Callus, score: 92.414	N	N	N	N
vg0910453386	C -> T	LOC_Os09g17049.2	downstream_gene_variant ; 618.0bp to feature; MODIFIER	silent_mutation	Average:15.514; most accessible tissue: Callus, score: 92.414	N	N	N	N
vg0910453386	C -> T	LOC_Os09g17049-LOC_Os09g17060	intergenic_region ; MODIFIER	silent_mutation	Average:15.514; most accessible tissue: Callus, score: 92.414	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0910453386	NA	2.77E-16	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910453386	NA	1.24E-12	mr1205	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910453386	NA	7.02E-07	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910453386	NA	3.56E-13	mr1330	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910453386	NA	5.36E-10	mr1332	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910453386	NA	3.25E-09	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910453386	NA	1.19E-06	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910453386	NA	8.55E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910453386	NA	4.53E-08	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910453386	NA	1.09E-06	mr1507	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910453386	1.41E-06	NA	mr1544	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910453386	NA	3.08E-13	mr1579	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910453386	NA	1.79E-20	mr1580	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910453386	NA	8.19E-08	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910453386	NA	3.31E-24	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910453386	NA	1.42E-11	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910453386	NA	1.53E-06	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910453386	NA	2.04E-08	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910453386	NA	3.23E-08	mr1680	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910453386	NA	1.36E-10	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910453386	NA	2.46E-13	mr1701	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910453386	NA	1.03E-10	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910453386	NA	1.06E-08	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910453386	NA	9.61E-08	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910453386	NA	3.93E-07	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910453386	NA	1.31E-16	mr1825	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910453386	2.59E-06	NA	mr1977	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910453386	NA	6.64E-06	mr1977	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251