\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910450391:

Variant ID: vg0910450391 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10450391
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCATGTATAAAGATCTTGTCTAAACTCAACTTTTATGAGTTACAAAAATAACAAATTTCAAACTTTTGTTATGTTTGAAATTTAGTACAGTTTTTAAAA[G/C]
AATTTTTACAAGATTATGTAAAACTTTTGTTATGTTTGAAATTTAGTATAGTTTTTAGGAGAATTTTTACAAGATTATGTAAAATCGTCTCATCTACATG

Reverse complement sequence

CATGTAGATGAGACGATTTTACATAATCTTGTAAAAATTCTCCTAAAAACTATACTAAATTTCAAACATAACAAAAGTTTTACATAATCTTGTAAAAATT[C/G]
TTTTAAAAACTGTACTAAATTTCAAACATAACAAAAGTTTGAAATTTGTTATTTTTGTAACTCATAAAAGTTGAGTTTAGACAAGATCTTTATACATGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.40% 20.40% 0.57% 54.57% NA
All Indica  2759 8.50% 0.90% 0.83% 89.74% NA
All Japonica  1512 39.00% 58.50% 0.13% 2.45% NA
Aus  269 79.90% 6.30% 0.00% 13.75% NA
Indica I  595 14.80% 1.20% 0.67% 83.36% NA
Indica II  465 9.50% 0.90% 0.86% 88.82% NA
Indica III  913 3.50% 0.30% 1.10% 95.07% NA
Indica Intermediate  786 9.00% 1.40% 0.64% 88.93% NA
Temperate Japonica  767 61.90% 36.40% 0.26% 1.43% NA
Tropical Japonica  504 8.90% 88.50% 0.00% 2.58% NA
Japonica Intermediate  241 28.60% 66.00% 0.00% 5.39% NA
VI/Aromatic  96 82.30% 11.50% 0.00% 6.25% NA
Intermediate  90 41.10% 31.10% 2.22% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910450391 G -> DEL N N silent_mutation Average:8.321; most accessible tissue: Callus, score: 41.065 N N N N
vg0910450391 G -> C LOC_Os09g17040.1 upstream_gene_variant ; 1958.0bp to feature; MODIFIER silent_mutation Average:8.321; most accessible tissue: Callus, score: 41.065 N N N N
vg0910450391 G -> C LOC_Os09g17049.2 upstream_gene_variant ; 534.0bp to feature; MODIFIER silent_mutation Average:8.321; most accessible tissue: Callus, score: 41.065 N N N N
vg0910450391 G -> C LOC_Os09g17060.1 downstream_gene_variant ; 3975.0bp to feature; MODIFIER silent_mutation Average:8.321; most accessible tissue: Callus, score: 41.065 N N N N
vg0910450391 G -> C LOC_Os09g17049.1 intron_variant ; MODIFIER silent_mutation Average:8.321; most accessible tissue: Callus, score: 41.065 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910450391 NA 5.53E-06 mr1041 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 8.49E-06 NA mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 NA 7.32E-16 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 NA 6.04E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 NA 3.16E-10 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 NA 1.89E-08 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 NA 9.35E-06 mr1319 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 NA 2.12E-12 mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 NA 1.18E-09 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 NA 4.17E-09 mr1338 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 NA 2.42E-08 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 NA 1.28E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 NA 1.42E-06 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 NA 1.02E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 2.02E-06 4.35E-08 mr1507 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 NA 3.01E-13 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 NA 9.00E-13 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 NA 2.21E-09 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 NA 1.83E-23 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 NA 9.71E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 NA 2.10E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 NA 5.93E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 NA 1.36E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 NA 2.82E-08 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 NA 3.33E-09 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 NA 3.72E-12 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 9.43E-06 NA mr1692 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 3.55E-06 NA mr1711 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 NA 6.63E-12 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 NA 4.51E-09 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 NA 1.53E-06 mr1809 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 4.87E-06 1.29E-09 mr1810 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 NA 1.93E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 NA 2.42E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910450391 NA 2.22E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251